Advertisement

Antidepressant-like effects of transcorneal electrical stimulation in rat models

Open AccessPublished:May 27, 2022DOI:https://doi.org/10.1016/j.brs.2022.05.018

      Highlights

      • TES induced antidepressant-like activities in S334ter-line-3 rat model of retinal degeneration.
      • TES induced antidepressant-like effects through both neurogenesis-dependent and -independent mechanisms in CUS-induced rat model of depression.
      • TES reduced plasma corticosterone levels and upregulated neurogenesis-related gene expression.
      • TES normalized protein expression of apoptotic and neuroplasticity markers in the hippocampus and amygdala.

      Abstract

      Background

      Given that visual impairment is bi-directionally associated with depression, we examined whether transcorneal electrical stimulation (TES), a non-invasive treatment for visual disorders, can ameliorate depressive symptoms.

      Objective

      The putative antidepressant-like effects of TES and the underlying mechanisms were investigated in an S334ter-line-3 rat model of retinal degeneration and a rat model of chronic unpredictable stress (CUS).

      Methods

      TES was administered daily for 1 week in S334ter-line-3 and CUS rats. The effects of TES on behavioral parameters, plasma corticosterone levels, and different aspects of neuroplasticity, including neurogenesis, synaptic plasticity, and apoptosis, were examined.

      Results

      In S334ter-line-3 rats, TES induced anxiolytic and antidepressant-like behaviors in the cylinder, open field, home cage emergence, and forced swim tests. In the CUS rat model, TES induced hedonic-like behavior and decreased behavioral despair, which were accompanied by reduced plasma corticosterone levels and upregulated expression of neurogenesis-related genes. Treatment with the neurogenesis blocker temozolomide only inhibited the hedonic-like effect of TES, suggesting the antidepressant-like effects of TES were mediated through both neurogenesis-dependent and -independent mechanisms. Furthermore, TES was found to normalize the protein expression of synaptic markers and apoptotic Bcl-2-associated X protein in the hippocampus and amygdala in the CUS rat model. The improvements in neuroplasticity may involve protein kinase B (AKT) and protein kinase A (PKA) signaling pathways in the hippocampus and amygdala, respectively, as demonstrated by the altered pAKT/AKT and pPKA/PKA ratios.

      Conclusion

      The overall findings suggest a possible neuroplasticity mechanism of the antidepressant-like effects of TES.

      Keywords

      1. Introduction

      Depression is a significant contributor to the global disability burden [
      • Wang J.
      • Wu X.
      • Lai W.
      • Long E.
      • Zhang X.
      • Li W.
      • et al.
      Prevalence of depression and depressive symptoms among outpatients: a systematic review and meta-analysis.
      ]. It has been suggested that depression is 25% more prevalent in visually impaired individuals [
      • Zheng Y.
      • Wu X.
      • Lin X.
      • Lin H.
      The prevalence of depression and depressive symptoms among eye disease patients: a systematic review and meta-analysis.
      ]. A longitudinal study demonstrated a bidirectional association between visual impairment and symptoms of depression and anxiety [
      • Frank C.R.
      • Xiang X.
      • Stagg B.C.
      • Ehrlich J.R.
      Longitudinal associations of self-reported vision impairment with symptoms of anxiety and depression among older adults in the United States.
      ]. There is a close relationship between emotional and visual systems, as reflected by their functional connections in the brain. The visual and emotional systems are extensively interconnected at the cortical and subcortical levels, with visual inputs transmitted to the limbic regions, including the hippocampus and amygdala [
      • McFadyen J.
      • Mattingley J.B.
      • Garrido M.I.
      An afferent white matter pathway from the pulvinar to the amygdala facilitates fear recognition.
      ,
      • Diederich N.J.
      • Stebbins G.
      • Schiltz C.
      • Goetz C.G.
      Are patients with Parkinson's disease blind to blindsight?.
      ,
      • Pessoa L.
      • Adolphs R.
      Emotion processing and the amygdala: from a'low road'to'many roads' of evaluating biological significance.
      ,
      • Tsanov M.
      • Manahan-Vaughan D.
      Synaptic plasticity from visual cortex to hippocampus: systems integration in spatial information processing.
      ,
      • Suzuki W.A.
      • Amaral D.G.
      Topographic organization of the reciprocal connections between the monkey entorhinal cortex and the perirhinal and parahippocampal cortices.
      ]. Interestingly, transcorneal electrical stimulation (TES), a non-invasive treatment for retinal and optic neuropathies, has been found to activate both visual and non-visual brain regions. A human study using 18F-fluorodeoxyglucose positron emission tomography revealed that TES activated the visual cortex, prefrontal cortex, inferior temporal gyrus, and parahippocampal gyrus [
      • Xie J.
      • Wang G.-J.
      • Yow L.
      • Cela C.J.
      • Humayun M.S.
      • Weiland J.D.
      • et al.
      Modeling and percept of transcorneal electrical stimulation in humans.
      ]. Nevertheless, most studies on TES have focused on improving visual functions [
      • Morimoto T.
      • Miyoshi T.
      • Matsuda S.
      • Tano Y.
      • Fujikado T.
      • Fukuda Y.
      Transcorneal electrical stimulation rescues axotomized retinal ganglion cells by activating endogenous retinal IGF-1 system.
      ,
      • Morimoto T.
      • Miyoshi T.
      • Sawai H.
      • Fujikado T.
      Optimal parameters of transcorneal electrical stimulation (TES) to be neuroprotective of axotomized RGCs in adult rats.
      ,
      • Tagami Y.
      • Kurimoto T.
      • Miyoshi T.
      • Morimoto T.
      • Sawai H.
      • Mimura O.
      Axonal regeneration induced by repetitive electrical stimulation of crushed optic nerve in adult rats.
      ,
      • Henrich-Noack P.
      • Lazik S.
      • Sergeeva E.
      • Wagner S.
      • Voigt N.
      • Prilloff S.
      • et al.
      Transcorneal alternating current stimulation after severe axon damage in rats results in “long-term silent survivor” neurons.
      ,
      • Henrich-Noack P.
      • Voigt N.
      • Prilloff S.
      • Fedorov A.
      • Sabel B.A.
      Transcorneal electrical stimulation alters morphology and survival of retinal ganglion cells after optic nerve damage.
      ,
      • Miyake K-i
      • Yoshida M.
      • Inoue Y.
      • Hata Y.
      Neuroprotective effect of transcorneal electrical stimulation on the acute phase of optic nerve injury.
      ,
      • Osako T.
      • Chuman H.
      • Maekubo T.
      • Ishiai M.
      • Kawano N.
      • Nao-i N.
      Effects of steroid administration and transcorneal electrical stimulation on the anatomic and electrophysiologic deterioration of nonarteritic ischemic optic neuropathy in a rodent model.
      ,
      • Wang X.
      • Mo X.
      • Li D.
      • Wang Y.
      • Fang Y.
      • Rong X.
      • et al.
      Neuroprotective effect of transcorneal electrical stimulation on ischemic damage in the rat retina.
      ,
      • Fu L.
      • Fung F.K.
      • Lo A.C.-Y.
      • Chan Y.-K.
      • So K.-F.
      • Wong I.Y.-H.
      • et al.
      Transcorneal electrical stimulation inhibits retinal microglial activation and enhances retinal ganglion cell survival after acute ocular hypertensive injury.
      ,
      • Morimoto T.
      • Fujikado T.
      • Choi J.-S.
      • Kanda H.
      • Miyoshi T.
      • Fukuda Y.
      • et al.
      Transcorneal electrical stimulation promotes the survival of photoreceptors and preserves retinal function in royal college of surgeons rats.
      ,
      • Morimoto T.
      • Kanda H.
      • Kondo M.
      • Terasaki H.
      • Nishida K.
      • Fujikado T.
      Transcorneal electrical stimulation promotes survival of photoreceptors and improves retinal function in rhodopsin P347L transgenic rabbits.
      ,
      • Rahmani S.
      • Bogdanowicz L.
      • Thomas J.
      • Hetling J.R.
      Chronic delivery of low-level exogenous current preserves retinal function in pigmented P23H rat.
      ,
      • Ni Y-q
      • Gan D-k
      • Xu H-d
      • Xu G-z
      Neuroprotective effect of transcorneal electrical stimulation on light-induced photoreceptor degeneration.
      ,
      • Schatz A.
      • Röck T.
      • Naycheva L.
      • Willmann G.
      • Wilhelm B.
      • Peters T.
      • et al.
      Transcorneal electrical stimulation for patients with retinitis pigmentosa: a prospective, randomized, sham-controlled exploratory study.
      ,
      • Schatz A.
      • Pach J.
      • Gosheva M.
      • Naycheva L.
      • Willmann G.
      • Wilhelm B.
      • et al.
      Transcorneal electrical stimulation for patients with retinitis pigmentosa: a prospective, randomized, sham-controlled follow-up study over 1 year.
      ,
      • Naycheva L.
      • Schatz A.
      • Willmann G.
      • Bartz-Schmidt K.U.
      • Zrenner E.
      • Röck T.
      • et al.
      Transcorneal electrical stimulation in patients with retinal artery occlusion: a prospective, randomized, sham-controlled pilot study.
      ,
      • Inomata K.
      • Shinoda K.
      • Ohde H.
      • Tsunoda K.
      • Hanazono G.
      • Kimura I.
      • et al.
      Transcorneal electrical stimulation of retina to treat longstanding retinal artery occlusion.
      ,
      • Oono S.
      • Kurimoto T.
      • Kashimoto R.
      • Tagami Y.
      • Okamoto N.
      • Mimura O.
      Transcorneal electrical stimulation improves visual function in eyes with branch retinal artery occlusion.
      ,
      • Fujikado T.
      • Morimoto T.
      • Matsushita K.
      • Shimojo H.
      • Okawa Y.
      • Tano Y.
      Effect of transcorneal electrical stimulation in patients with nonarteritic ischemic optic neuropathy or traumatic optic neuropathy.
      ], while its effects on non-visual systems, especially its psychiatric effects, have not been extensively explored [
      • Yu W.-S.
      • Kwon S.-H.
      • Agadagba S.K.
      • Chan L.-L.-H.
      • Wong K.-H.
      • Lim L.-W.
      Neuroprotective effects and therapeutic potential of transcorneal electrical stimulation for depression.
      ].
      Several pioneering studies reported that TES had behavioral effects in rodent kindling models. It was suggested that the behavioral changes in corneally kindled animals correlated with enhanced neuronal activity throughout the brain, including the hippocampus and amygdala [
      • Albertini G.
      • Walrave L.
      • Demuyser T.
      • Massie A.
      • De Bundel D.
      • Smolders I.
      6 Hz corneal kindling in mice triggers neurobehavioral comorbidities accompanied by relevant changes in c-Fos immunoreactivity throughout the brain.
      ,
      • Koshal P.
      • Kumar P.
      Effect of liraglutide on corneal kindling epilepsy induced depression and cognitive impairment in mice.
      ,
      • Wlaź P.
      • Poleszak E.
      • Serefko A.
      • Wlaź A.
      • Rundfeldt C.
      Anxiogenic-and antidepressant-like behavior in corneally kindled rats.
      ]. However, the antidepressant-like outcomes of TES in these studies were contradictory. Furthermore, high-intensity stimulation was used to establish these kindled animal models, which was associated with a high mortality rate. Therefore, this animal model may not be ideal for assessing the therapeutic potential of TES for depression in humans.
      In this study, we tested the hypothesis that TES induces antidepressant-like activities in preclinical models of depression. Using multiple methodological approaches, we explored the effects of TES on depression in an S334ter-line-3 rat model of retinal degeneration and a rat model of depression induced by a chronic unpredictable stress (CUS) paradigm. Given that neuroplastic changes are closely related to the development of depression [
      • Pittenger C.
      • Duman R.S.
      Stress, depression, and neuroplasticity: a convergence of mechanisms.
      ] and that enhanced neuroplasticity is reported to be a common mechanism of action of various electrical brain stimulation methods [
      • Huang Y.
      • Li Y.
      • Chen J.
      • Zhou H.
      • Tan S.
      Electrical stimulation elicits neural stem cells activation: new perspectives in CNS repair.
      ,
      • Liu A.
      • Jain N.
      • Vyas A.
      • Lim L.W.
      Ventromedial prefrontal cortex stimulation enhances memory and hippocampal neurogenesis in the middle-aged rats.
      ], we also investigated the potential role of neuroplasticity in the effects of TES. Specifically, the neurogenesis-dependent effects of TES were tested through a reversal experiment, in which the CUS rats were subjected to TES followed by injection with temozolomide (TMZ), a DNA alkylating agent that inhibits neurogenesis [
      • Bambico F.R.
      • Bregman T.
      • Diwan M.
      • Li J.
      • Darvish-Ghane S.
      • Li Z.
      • et al.
      Neuroplasticity-dependent and -independent mechanisms of chronic deep brain stimulation in stressed rats.
      ].

      2. Materials and methods

      2.1 Animals

      All experimental procedures were approved by the Committee on the Use of Live Animals in Teaching and Research, the University of Hong Kong (Ref.: 4945-19). All rats were housed in pairs in a temperature- and humidity-controlled room (25 ± 1 °C and 60%–65% humidity) under a 12-h light/dark cycle (lights on at 21:00) with access to food and water ad libitum.

      2.1.1 Rat model of retinal degeneration

      Ten-week-old male S334ter-line-3 rats and Long Evans (LE) rats were used as the retinal degeneration model and healthy controls, respectively. The rats were obtained from the Laboratory Animal Services Centre of the Chinese University of Hong Kong. S334ter-line-3 rats were bred from transgenic homozygotes and pigmented LE rats [
      • Chen K.
      • Wang Y.
      • Liang X.
      • Zhang Y.
      • Ng T.K.
      • Chan L.L.
      Electrophysiology alterations in primary visual cortex neurons of retinal degeneration (S334ter-line-3) rats.
      ]. Details of the generation of S334ter-line-3 rats have been described previously [
      • Chen J.
      • Makino C.L.
      • Peachey N.S.
      • Baylor D.A.
      • Simon M.I.
      Mechanisms of rhodopsin inactivation in vivo as revealed by a COOH-terminal truncation mutant.
      ,
      • LaVail M.M.
      • Nishikawa S.
      • Steinberg R.H.
      • Naash M.I.
      • Duncan J.L.
      • Trautmann N.
      • et al.
      Phenotypic characterization of P23H and S334ter rhodopsin transgenic rat models of inherited retinal degeneration.
      ].

      2.1.2 Rat model of chronic unpredictable stress (CUS)

      Twelve-week-old male Sprague-Dawley (SD) rats were obtained from the Laboratory Animal Unit of the University of Hong Kong.The CUS paradigm was performed as previously described [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ,
      • Huguet G.
      • Kadar E.
      • Temel Y.
      • Lim L.W.
      Electrical stimulation normalizes c-Fos expression in the deep cerebellar nuclei of depressive-like rats: implication of antidepressant activity.
      ]. Briefly, SD rats were exposed to various stressors for 3 consecutive weeks. Stressors in the CUS protocol included intermittent illumination every 2 h, stroboscopic illumination (2.5 Hz), water and/or food deprivation, individual housing, crowded housing, damp bedding (300 mL cold tap water), dirty cage with excreta from other rats, and loud noises. One stressor was applied every 12 h daily, with the order of stressors randomized to maintain unpredictability.

      2.2 Experimental design

      We conducted two systematic studies to evaluate the antidepressant-like effects of TES. In Study 1, the effects of TES on behavioral outcomes were examined in a rat model of retinal degeneration (Fig. 1A). S334ter-line-3 rats (TES 100 μA, n = 6; TES 200 μA, n = 8; TES 500 μA, n = 6; and sham, n = 12) and LE control rats (TES 100 μA, n = 8; TES 200 μA, n = 6; TES 500 μA, n = 6; and sham, n = 11) received daily TES or sham treatment for 1 week before behavioral assessments. Anxiety-like behaviors were assessed by cylinder exploration, open field, and home cage emergence tests, whereas behavioral despair was assessed by the forced swim test [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ]. Animals were sacrificed one day after the last behavioral assessment and retinal tissues were collected for histological workup. The S334ter-line-3 model has been reported to exhibit progressive loss of visually evoked activity in the superior colliculus which might prevent the transmission of TES-induced input to the visually connected brain regions [
      • Sagdullaev B.T.
      • Aramant R.B.
      • Seiler M.J.
      • Woch G.
      • McCall M.A.
      Retinal transplantation–induced recovery of retinotectal visual function in a rodent model of retinitis pigmentosa.
      ]. To this end, we also conducted an electrophysiology experiment in a separate batch of S334ter-line-3 rats to assess the integrity of the visual pathway [
      • Chen K.
      • Wang Y.
      • Liang X.
      • Zhang Y.
      • Ng T.K.
      • Chan L.L.
      Electrophysiology alterations in primary visual cortex neurons of retinal degeneration (S334ter-line-3) rats.
      ,
      • Wang Y.
      • Chen K.
      • Chan L.L.H.
      Responsive neural activities in the primary visual cortex of retina-degenerated rats.
      ].
      Fig. 1
      Fig. 1Effects of TES on behavioral outcomes in S334ter-line-3 rats. (A) Schematic representation of the experimental timeline and procedure of TES. 10-month-old male S334ter-line-3 rats and control rats were subjected to 1 week of TES before behavioral testing for anxiety- and depression-related behaviors. TES was administered at 100, 200, or 500 μA using a stimulator and stimulus isolator unit. A needle reference electrode was inserted to the ear. (B) Assessment of locomotor activity and anxiety-like behavior by immobility time and rearing frequency in the cylinder test. The sham-treated S334ter-line-3 rats exhibited reduced locomotion and increased anxiety-like behavior, as indicated by significantly increased immobility time and decreased exploratory rearing behavior compared to control rats. TES at 100, 200, and 500 μA in S334ter-line-3 rats effectively reduced immobility and increased rearing. TES at 100 μA in control rats increased rearing frequency. (C) Assessment of general locomotion and anxious-like behavior by distance traveled and ratio of time spent in the center to periphery zones in the OFT. The sham-treated S334ter-line-3 rats showed a shorter distance traveled and time spent in the center zone when compared with control rats, suggesting a reduction in locomotor activity and an anxiety-like response, respectively. In S334ter-line-3 rats, TES at all tested amplitudes increased distance traveled, whereas TES at 100 μA and 200 μA increased time spent in the center zone. In control rats, TES at 100 μA reduced distance traveled. (D) Assessment of anxiety-like behavior by escape latency in the HCET. The sham-treated S334ter-line-3 rats exhibited increased latency to escape from the home cage, indicating an anxiety-like response. TES at all tested amplitudes reduced the latency to escape only in S334ter-line-3 rats. (E) Assessment of behavioral despair by immobility time in the FST. TES at 100 and 200 μA markedly reduced immobility in S334ter-line-3 rats, suggesting a decrease in despair-like behavior. Data are presented as mean + SEM.p < 0.05; ∗∗p ≤ 0.01; ∗∗∗p ≤ 0.001.
      In Study 2, the antidepressant-like effects of TES were examined in a CUS rat model (Fig. 4A). Daily TES or sham treatments were applied in week 3 during the CUS process, whereas the non-CUS control rats were left undisturbed (non-CUS, n = 7; TES 200 μA, n = 7; sham, n = 9). Additionally, a group of TES-treated CUS rats were intraperitoneally injected with TMZ (25 mg/kg, SelleckChem, Texas, USA) on stimulation days 1, 3, and 5 to block cell proliferation [
      • Bambico F.R.
      • Bregman T.
      • Diwan M.
      • Li J.
      • Darvish-Ghane S.
      • Li Z.
      • et al.
      Neuroplasticity-dependent and -independent mechanisms of chronic deep brain stimulation in stressed rats.
      ] so as to assess the neurogenesis-dependent and -independent effects of TES (n = 7). Locomotor ability was assessed in the open field test [
      • Tatem K.S.
      • Quinn J.L.
      • Phadke A.
      • Yu Q.
      • Gordish-Dressman H.
      • Nagaraju K.
      Behavioral and locomotor measurements using an open field activity monitoring system for skeletal muscle diseases.
      ], whereas anhedonia and behavioral despair were measured using the sucrose preference test and forced swim test, respectively [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ]. Rats were sacrificed one day after the last behavioral assessment. Blood plasma was collected for measuring corticosterone level [
      • Hestermann D.
      • Temel Y.
      • Blokland A.
      • Lim L.W.
      Acute serotonergic treatment changes the relation between anxiety and HPA-axis functioning and periaqueductal gray activation.
      ] and brain tissue was harvested for measuring the expression of hippocampal neurogenesis-related genes. Immunoblotting was carried out to analyze neuroplasticity- and apoptosis-associated markers in the hippocampus and amygdala.

      2.3 Transcorneal electrical stimulation

      Animals were anesthetized by intraperitoneal injection of ketamine (70 mg/kg) and diazepam (7 mg/kg). A ring-shaped non-invasive stimulating electrode was placed on the cornea and eye moisturizing gel (Dechra, Northwich, UK) was applied to prevent dehydration. Electrical currents were delivered using a digital stimulator model 3800 and stimulus isolators model 3820 (A-M Systems Inc., Sequim, USA) at a frequency of 20 Hz, pulse width of 1 ms, and amplitude of 100, 200, or 500 μA. The parameters were chosen based on previous research that reported TES had neuroprotective effects in the retina [
      • Morimoto T.
      • Miyoshi T.
      • Matsuda S.
      • Tano Y.
      • Fujikado T.
      • Fukuda Y.
      Transcorneal electrical stimulation rescues axotomized retinal ganglion cells by activating endogenous retinal IGF-1 system.
      ,
      • Morimoto T.
      • Miyoshi T.
      • Sawai H.
      • Fujikado T.
      Optimal parameters of transcorneal electrical stimulation (TES) to be neuroprotective of axotomized RGCs in adult rats.
      ,
      • Miyake K-i
      • Yoshida M.
      • Inoue Y.
      • Hata Y.
      Neuroprotective effect of transcorneal electrical stimulation on the acute phase of optic nerve injury.
      ,
      • Morimoto T.
      • Fujikado T.
      • Choi J.-S.
      • Kanda H.
      • Miyoshi T.
      • Fukuda Y.
      • et al.
      Transcorneal electrical stimulation promotes the survival of photoreceptors and preserves retinal function in royal college of surgeons rats.
      ,
      • Schatz A.
      • Arango-Gonzalez B.
      • Fischer D.
      • Enderle H.
      • Bolz S.
      • Röck T.
      • et al.
      Transcorneal electrical stimulation shows neuroprotective effects in retinas of light-exposed rats.
      ,
      • Willmann G.
      • Schäferhoff K.
      • Fischer M.D.
      • Arango-Gonzalez B.
      • Bolz S.
      • Naycheva L.
      • et al.
      Gene expression profiling of the retina after transcorneal electrical stimulation in wild-type Brown Norway rats.
      ]. The impedance of the stimulating electrodes was 112 ± 4.2 Ω at 1 kHz, and 85.1 ± 1.8 Ω at 100 kHz. The sham groups were similarly treated but without electrical stimulation.

      2.4 Behavioral testing

      All tests were conducted during the dark cycle in dim light condition by researchers blinded to the treatment conditions. Animal behaviors were recorded and scored using the ANY-maze behavioral tracking software (Stoelting Co., USA).

      2.4.1 Cylinder test

      Briefly, rats were placed in an open-top transparent Plexiglas cylinder (height 50 cm x diameter 20 cm). Immobility and rearing behaviors (vertical exploration while standing on hind legs) were recorded during the 10-min test period.

      2.4.2 Open field test (OFT)

      The OFT was performed as previously described [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ]. This test was conducted in a lid-free white Plexiglas square box (100 x 100 × 40 cm3) with a dark floor. Rats were placed in the central area and allowed to explore for 5 min. Behaviors including distance traveled and time spent in the center and peripheral zones were recorded and scored.

      2.4.3 Home cage emergence test (HCET)

      This test was performed as previously described with minor modifications [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ,
      • Hiew L.F.
      • Khairuddin S.
      • Aquili L.
      • Koh J.
      • Fung M.L.
      • Lim W.L.
      • et al.
      Behavioural responses of anxiety in aversive and non-aversive conditions between young and aged Sprague-Dawley rats.
      ]. Briefly, the rats’ home cage was placed on a platform with the cage lid removed. A grid walkway was placed over the edge of the home cage to facilitate escape. The escape latency, which is the time to emerge from the home cage, was recorded and scored. If rats did not escape the home cage within 10 min, they were given a score of 600 s.

      2.4.4 Sucrose preference test (SuPT)

      Rats were habituated to drinking 1% sucrose solution for 1 h, and then restricted to food and water for 14 h. Thereafter, rats were provided bottles of pre-weighed water and 1% sucrose solution for 1 h. Sucrose preference was calculated as the percentage of sucrose consumed relative to the total liquid intake [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ,
      • Lim L.W.
      • Janssen M.L.
      • Kocabicak E.
      • Temel Y.
      The antidepressant effects of ventromedial prefrontal cortex stimulation is associated with neural activation in the medial part of the subthalamic nucleus.
      ].

      2.4.5 Forced swim test (FST)

      This test was performed as previously described [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ,
      • Lim L.W.
      • Janssen M.L.
      • Kocabicak E.
      • Temel Y.
      The antidepressant effects of ventromedial prefrontal cortex stimulation is associated with neural activation in the medial part of the subthalamic nucleus.
      ,
      • Yankelevitch-Yahav R.
      • Franko M.
      • Huly A.
      • Doron R.
      The forced swim test as a model of depressive-like behavior.
      ]. Rats were placed in a cylindrical Plexiglas tank (height 50 cm x diameter 20 cm) filled with tap water (25 ± 1 °C) to a height of 30 cm. Rats were allowed to swim in the water tank for 15 min in a pretest session to acclimate them to the novel swimming behavior. This was followed by a 10-min test session on the next day. The immobility duration, defined as a period of no movement or slight and infrequent movements with the nose maintained above water, was recorded.

      2.5 Electrophysiology

      Electrophysiology experiment was performed as previously described (Fig. 2A) [
      • Bambico F.R.
      • Bregman T.
      • Diwan M.
      • Li J.
      • Darvish-Ghane S.
      • Li Z.
      • et al.
      Neuroplasticity-dependent and -independent mechanisms of chronic deep brain stimulation in stressed rats.
      ,
      • Chan L.L.
      • Lee E.-J.
      • Humayun M.S.
      • Weiland J.D.
      Both electrical stimulation thresholds and SMI-32-immunoreactive retinal ganglion cell density correlate with age in S334ter line 3 rat retina.
      ]. Briefly, epiretinal stimulation of the left eye was conducted in S334ter-line-3 (n = 5) and control (n = 4) rats. Charge-balanced biphasic currents (5–50 μA, 50 trials per threshold level) were applied to the retinal surface across three pulse durations (0.5, 1.0, and 1.5 ms). Retinal evoked responses from the contralateral superior colliculus were recorded.

      2.6 Retinal histology

      Rats were euthanized one day after the last behavioral assessment using sodium pentobarbital (Dorminal 20%, Alfasan, Woerden, Holland). The stimulated eyes of S334ter-line-3 and LE rats were enucleated and fixed in 4% paraformaldehyde in phosphate buffered solution at 4 °C overnight. Samples were cryoprotected in 15% and 30% sucrose solution overnight and subsequently frozen in liquid nitrogen. Samples were sectioned into 20-μm thick slices using a CryoStar NX50 Cryostat (Thermo Scientific, Massachusetts USA). Standard hematoxylin-eosin (H&E) staining was performed. Images of the stained retina were obtained at 20X using a Zeiss Axioplan 2 microscope equipped with an Olympus DP73 camera. Thickness of the retinal layers in the central region (1 mm from the optic disk) was measured with ImageJ (National Institutes of Health, Maryland, USA).

      2.7 Corticosterone radioimmunoassay

      This assay was performed as previously described [
      • Hestermann D.
      • Temel Y.
      • Blokland A.
      • Lim L.W.
      Acute serotonergic treatment changes the relation between anxiety and HPA-axis functioning and periaqueductal gray activation.
      ]. Animals were sacrificed one day after the last behavioral assessment. Blood was collected in sampling tubes containing EDTA (1.5 mg/mL, Sigma-Aldrich, Massachusetts, USA) and centrifuged at 14000 rpm for 5 min at 4 °C. The supernatant was collected as plasma and extracted with dichloromethane, followed by vortexing for 1 min. Corticosterone level was determined directly from the dried dichloromethane extracts by radioimmunoassay using corticosterone-125I. The radioimmunological reaction was conducted overnight at 4 °C, followed by the separation of unbound steroids.

      2.8 Real-time PCR

      The procedures were performed according to a previously published protocol [
      • Liu A.
      • Jain N.
      • Vyas A.
      • Lim L.W.
      Ventromedial prefrontal cortex stimulation enhances memory and hippocampal neurogenesis in the middle-aged rats.
      ,
      • Guan L.
      • Yu W.S.
      • Shrestha S.
      • Or Y.Z.
      • Lufkin T.
      • Chan Y.S.
      • et al.
      TTC9A deficiency induces estradiol-mediated changes in hippocampus and amygdala neuroplasticity-related gene expressions in female mice.
      ]. The hippocampus was grossly dissected from freshly frozen brain tissues of the CUS rats. Total RNA was extracted from the hippocampus using TRizol™ reagent (Invitrogen, Massachusetts, USA) and reverse transcribed using PrimerScript™ RT reagent kit with gDNA eraser (Takara Bio Inc., Shiga, Japan). Real-time PCR was performed using a Roche LightCycler 480 II (Roche Diagnostics, Basel, Switzerland) with TB Green® Premix Ex TaqTM (RR420A, TaKaRa). Hypoxanthine guanine phosphoribosyltransferase (Hprt) was used as the internal control for mRNA expression. Fold change was determined relative to the TES sham group after normalizing to Hprt using the 2-(ΔΔCt) method. The primers (Integrated DNA Technologies, Iowa, USA) used in this study were as follows: Ki67 (forward 5′-ACTTGCCTCCTAATACTCCACTCA-3′, reverse 5′-ATCTTCGTCTTTCATCATTTGTCC-3’ [
      • Chen Y.C.
      • Shi L.
      • Zhu G.Y.
      • Wang X.
      • Liu D.F.
      • Liu Y.Y.
      • et al.
      Effects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats.
      ]), Nestin (forward 5′-TAAGTTCCAGCTGGCTGTGG-3′, reverse 5′-ATAGGTGGGATGGGAGTGCT-3’ [
      • Liu A.
      • Jain N.
      • Vyas A.
      • Lim L.W.
      Ventromedial prefrontal cortex stimulation enhances memory and hippocampal neurogenesis in the middle-aged rats.
      ]), Dcx (forward 5′-CTCCTATCTCTACACCCACAAGCC-3′, reverse 5′-GAATCGCCAAGTGAATCAGAGTC-3’ [
      • Kadar E.
      • Lim L.W.
      • Carreras G.
      • Genis D.
      • Temel Y.
      • Huguet G.
      High-frequency stimulation of the ventrolateral thalamus regulates gene expression in hippocampus, motor cortex and caudate-putamen.
      ]), Neun (forward 5′-GGCTGGAAGCTAAACCCTGT-3′, reverse 5′-TCCGATGCTGTAGGTTGCTG-3’ [
      • Liu A.
      • Jain N.
      • Vyas A.
      • Lim L.W.
      Ventromedial prefrontal cortex stimulation enhances memory and hippocampal neurogenesis in the middle-aged rats.
      ]), and Hprt (forward 5′-CTCATGGACTGATTATGGACAGGAC-3′, reverse 5′GCAGGTCAGCAAAGAACTTATAGCC -3’ [
      • Shi M.
      • Cho H.
      • Inn K.S.
      • Yang A.
      • Zhao Z.
      • Liang Q.
      • et al.
      Negative regulation of NF-kappaB activity by brain-specific TRIpartite Motif protein 9.
      ]).

      2.9 Western blotting

      The procedures were performed as previously described [
      • Chong P.S.
      • Khairuddin S.
      • Tse A.C.K.
      • Hiew L.F.
      • Lau C.L.
      • Tipoe G.L.
      • et al.
      Hericium erinaceus potentially rescues behavioural motor deficits through ERK-CREB-PSD95 neuroprotective mechanisms in rat model of 3-acetylpyridine-induced cerebellar ataxia.
      ,
      • Chong P.S.
      • Poon C.H.
      • Roy J.
      • Tsui K.C.
      • Lew S.Y.
      • Phang M.W.L.
      • et al.
      Neurogenesis-dependent antidepressant-like activity of Hericium erinaceus in an animal model of depression.
      ]. The amygdala and hippocampus of the CUS rats were rapidly isolated by gross dissection. Total proteins were extracted by homogenization in lysis buffer with a Halt™ protease and phosphatase inhibitor cocktail (Thermo Scientific), and protein concentration was determined by Bradford assay (Thermo Scientific). Protein samples (10–20 μg) were resolved by 10% SDS-PAGE and then transferred onto PVDF membranes using a semi-dry electroblotting system. The membranes were blocked in 5% milk or BSA in TBS for 1 h at room temperature and incubated at 4 °C overnight with primary antibodies. Primary antibodies against pPKA CThr197 (1:1000, 4781, Cell Signaling Technology, Massachusetts, USA), PKA C-α (1:1000, 4782, Cell Signaling Technology), pAKTS473 (1:1000, 9271, Cell Signaling Technology), AKT (1:1000, 4691, Cell Signaling Technology), BAX (1:1000, 14796, Cell Signaling Technology), SYP (1:2000, 101002, Synaptic Systems, Goettingen, Germany), PSD95 (1:1000, ab18258, Abcam, Massachusetts, USA), and GAPDH (1:1000, 2118, Cell Signaling Technology) were used. After washing in TBS-T, the membranes were incubated in horseradish peroxidase-conjugated secondary antibody (1:2000, 65–6120, Invitrogen, Massachusetts, USA) for 2 h at room temperature. Immunoreactive bands were visualized by Clarity Western ECL Substrate (Bio-rad) using the ChemiDoc imaging system (Bio-Rad). Densitometric analysis of the bands was performed using Image Lab Software (Bio-Rad). The relative protein expression was normalized against GAPDH.

      2.10 Statistical analysis

      Data analysis was performed using IBM SPSS Statistics 27 (IBM, New York, USA). In study 1, behavioral and electrophysiology data were analyzed using a two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc test for multiple comparisons. Data from the histological study were analyzed by one-way ANOVA with Bonferroni post-hoc test. In Study 2, the results were analyzed by one-way ANOVA followed by multiple comparisons with Bonferroni correction. Spearman correlation coefficients were calculated to examine the association between neurogenesis-related markers and behavioral parameters. All data were presented as mean +S.E.M. Significance was defined as p < 0.05.

      3. Results

      3.1 TES induced antidepressant-like behaviors in S334ter-line-3 rats

      Behavioral comparisons were performed between S334ter-line-3 and LE control rats given TES or sham treatments to assess the effects of retinal degeneration and TES on anxiety- and depressive-like behaviors.
      In the cylinder test (Fig. 1B), two-way ANOVA revealed significant effects of TES and TES x genotype on immobility time (TES: F3,49 = 12.159, p < 0.001; genotype: F1,49 = 0.849, p = 0.361; TES x genotype: F3,49 = 10.014, p < 0.001) and rearing frequency (TES: F3,53 = 19.654, p < 0.001; genotype: F1,53 = 0.124, p = 0.726; TES x genotype: F3,53 = 11.065, p < 0.001). The sham-treated S334ter-line-3 rats showed an increased immobility time and a reduced rearing frequency when compared with sham-treated controls (ps < 0.001), suggesting a reduction in locomotor activity and an increase in anxiety-like behavior. Administration of TES at 100, 200, and 500 μA effectively restored locomotor activity and induced anxiolytic behavior in S334ter-line-3 rats, as reflected by increased mobility and rearing behaviors (ps < 0.001). Only TES at 100 μA increased rearing frequency in the control rats (p = 0.003).
      In the OFT (Fig. 1C), two-way ANOVA identified significant effects of TES and TES x genotype on distance traveled (TES: F3,53 = 7.889, p < 0.001; genotype: F1,53 = 2.206, p = 0.143; TES x genotype: F3,53 = 16.402, p < 0.001) and the ratio of time spent in center to periphery zones (TES: F3,49 = 3.489, p = 0.022; genotype: F1,49 = 0.18, p = 0.673; TES x genotype: F3,49 = 2.874, p = 0.046). The sham-treated S334terl-line-3 rats showed a shorter distance traveled (p < 0.001) and less time spent in the center zone (p = 0.007) compared with sham-treated control rats, indicating a deficit in locomotor activity and an anxiety-like response in S334ter-line-3 rats, respectively. Treatment with TES at all tested amplitudes improved locomotion in S334ter-line-3 rats as seen by the increased distance traveled (ps < 0.001), whereas only TES at 100 μA reduced the distance traveled in control rats (p = 0.015). Furthermore, TES at 100 and 200 μA in S334ter-line-3 rats increased the time spent in center zone (100 μA: p = 0.02; 200 μA: p = 0.004), suggesting an anxiolytic effect.
      In the HCET (Fig. 1D), two-way ANOVA show significant TES and TES x genotype effects on escape latency (TES: F3,52 = 13.379, p < 0.001; genotype: F1,52 = 0.959, p = 0.332; TES x genotype: F3,52 = 6.088, p < 0.001). The sham-treated S334ter-line-3 rats showed significantly longer escape latency compared with sham-treated control rats (p < 0.002), indicating an anxiety-like response. Administration of TES at all the tested amplitudes significantly shortened the escape latency only in S334ter-line-3 rats (100 μA: p < 0.001; 200 μA: p = 0.003, 500 μA: p < 0.001), which further suggests an anxiolytic effect induced by TES.
      In the FST (Fig. 1E), two-way ANOVA found significant main effects for TES (F3,46 = 3.105, p = 0.036), genotype (F1,46 = 25.489, p < 0.001), and TES x genotype (F3,46 = 4.704, p = 0.006) on immobility time. Differences between genotypes were observed among the TES-treated rats, with S334ter-line-3 rats showing significantly lower immobility time compared to control rats given the same TES treatments (TES 100 μA: p = 0.01; TES 200 μA: p < 0.001; TES 500 μA: p = 0.006), indicating a lower behavioral despair in the TES-treated transgenic rats. Furthermore, S334ter-line-3 rats treated with TES at 100 and 200 μA showed significantly decreased immobility time compared with the sham-treated rats (100 μA: p = 0.019; 200 μA: p = 0.01), suggesting a decrease in despair-like behavior after TES.

      3.2 Functional connectivity of the visual pathway was preserved in S334ter-line-3 rats

      Electrically evoked potentials (EEPs) elicited by direct retinal stimulation were measured in the superior colliculus of S334ter-line-3 and control rats. Two-way ANOVA found no significant effects of genotype and pulse duration on the response latency of neurons (genotype: F1,21 = 0.015, p = 0.903; pulse duration: F2,21 = 0.069, p = 0.934; genotype x pulse duration: F2,21 = 0.504, p = 0.611; Fig. 2B). We detected EEPs in both S334ter-line-3 and control rats (Fig. 2C–E), indicating the visual pathways from retina to superior colliculus were activated in both transgenic and control rats. The EEP response windows were observed from 5 to 20 ms and consisted of early responses and late responses. The early responses occurred at 5–8 ms and the late responses occurred at 10–20 ms within the 25 ms response window after stimulation. These results suggest that the functional connectivity through the visual pathway was preserved in the transgenic rats.
      Fig. 2
      Fig. 2Retinal provoked EEPs in S334ter-line-3 and control rats. (A) Schematic representation of the in vivo recording of retinal-evoked activity in the superior colliculus. (B) Response latencies of neurons in the superior colliculus. No differences were detected in response latency between transgenic and control rats with stimulus pulse durations of 0.5, 1.0, and 1.5 ms. Figures show (C) ten representative response traces, (D) raster plots of 50 stimulation trials, and (E) post-stimulus time histogram for control and transgenic rats. EEPs elicited by retinal stimulation were detected in both control and transgenic rats. EEPs response windows were observed from 5 to 20 ms, with the early responses occurring at 5–8 ms and the late responses occurring at 10–20 ms. Data are presented as mean + SEM. N.s., not significant.

      3.3 TES did not rescue the degenerating photoreceptor layer in S334ter-line-3 rats

      In S334ter-line-3 rats, there was reduced retinal thickness and loss of outer plexiform layer, outer nuclear layer, and inner and outer segments of photoreceptors compared with control rats (Fig. 3A). One-way ANOVA revealed a significant group difference in the thickness of the inner nuclear layer (F4,80 = 121.137, p < 0.001; Fig. 3B) and inner plexiform layer (F4,83 = 28.714, p < 0.001, Fig. 3C). The mean thicknesses of the inner nuclear layer and inner plexiform layer were significantly reduced in S334ter-line-3 rats regardless of TES treatments (ps < 0.001).
      Fig. 3
      Fig. 3H&E staining of normal and degenerated retinas. (A) Representative images of H&E staining of the retina of control and S334ter-line-3 rats with sham or TES treatments. Comparison of the thickness of the (B) inner nuclear layer and (C) inner plexiform layer in control and S334ter-line-3 rats with sham or TES treatments. The sham- and TES-treated S334ter-line-3 rats had significantly thinner inner nuclear layer and inner plexiform layer compared to control rats. Scale bar: 50 μm. Data are presented as mean + SEM. ∗∗∗p ≤ 0.001. GCL: ganglion cell layer; IPL: inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; IS: inner segment; OS: outer segment.

      3.4 TES induced antidepressant-like behaviors in the CUS rat model

      The effects of TES were further investigated in a CUS rat model of depression. In the OFT (Fig. 4B), one-way ANOVA found no significant group differences in the distance traveled (F3,27 = 2.613, p = 0.074).
      Fig. 4
      Fig. 4Effects of TES on behavioral outcomes, plasma corticosterone levels, and hippocampal neurogenesis-related gene expression in the CUS rat model. (A) A schematic representation of the experimental timeline and set-up for TES in the CUS model. 12-week-old SD rats were exposed to 3 weeks of CUS. TES at 200 μA was performed during the last week of CUS followed by behavioral testing for depressive-like behaviors. (B) In the OFT, the CUS and non-CUS rats showed comparable locomotor ability, as indicated by the similar total distance traveled. (C) In the SuPT, the sham-treated CUS rats showed anhedonic-like response, as indicated by a marked decrease in sucrose preference. The sucrose preference was restored by TES treatment, which was blocked by TMZ administration, suggesting a neurogenesis-dependent hedonic-like effect by TES. (D) In the FST, the sham-treated CUS rats exhibited behavioral despair, as demonstrated by increased immobility time. Administration of TES remarkably reduced immobility in the CUS rat model, which was unaltered with TMZ treatment, suggesting a neurogenesis-independent anti-despair-like effect of TES. (E) Plasma corticosterone level in the CUS model. The CUS rats had significantly increased plasma corticosterone level, indicating higher stress levels. Treatment with TES significantly reduced corticosterone back to the non-CUS level. TMZ injection blocked the effects of TES. (F) Real-time PCR analysis of neurogenesis-related genes in the hippocampus. CUS significantly reduced the expression of Ki67 and Dcx. TES treatment upregulated Ki67 and Nestin, but did not affect the expression of Dcx and NeuN. The administration of TMZ significantly abolished the effects of TES on Ki67 and Nestin expression. (G) Scatter plots displaying correlations between Ki67 and Nestin gene expression, sucrose preference and gene expression of Ki67 or Nestin, and forced swim immobility time and gene expression of Ki67 or Nestin in the CUS model. Data are presented as mean + SEM.p < 0.05; ∗∗p ≤ 0.01; ∗∗∗p ≤ 0.001.
      In the SuPT (Fig. 4C), one-way ANOVA identified a group difference in the sucrose preference (F3,23 = 7.765, p = 0.001). The sham-treated CUS rats had significantly reduced sucrose preference compared with the non-CUS control rats (p = 0.001), indicating an anhedonic-like response in the CUS rats. Treatment with TES at 200 μA effectively restored the reduced sucrose preference in the CUS rats compared to sham-treated rats (p = 0.01), indicating a hedonic-like effect induced by TES. Such an effect was not observed in the TMZ + TES-treated rats, implying hedonic effect of TES was via a neurogenesis-dependent mechanism.
      In the FST (Fig. 4D), one-way ANOVA showed a significant group difference in immobility time (F3,29 = 6.491, p = 0.002). The sham-treated CUS rats showed higher immobility compared with the non-CUS rats (p = 0.029), indicating an increase in behavioral despair in the CUS rats. The TES-treated rats with or without TMZ injection showed significantly lower immobility time (non-TMZ: p = 0.005; TMZ: p = 0.006), suggesting the anti-despair-like effects of TES were via a neurogenesis-independent mechanism.

      3.5 TES reduced plasma corticosterone levels in the CUS rat model

      We next determined the effects of CUS and TES on the level of corticosterone, a major stress hormone (Fig. 4E). One-way ANOVA revealed a significant group difference in the plasma corticosterone level (F3,29 = 11.562, p < 0.001). The sham-treated CUS rats had a significantly higher concentration of plasma corticosterone than non-CUS control rats (p < 0.001), indicating a higher stress level due to CUS. Treatment with TES effectively reduced the corticosterone level in CUS rats (p = 0.001). Treatment with TMZ + TES increased corticosterone level compared with TES alone (p = 0.046) to a level comparable to the sham-treated group.

      3.6 TES upregulated neurogenesis-related markers in the CUS rat model

      The gene expression of neurogenesis-related markers in the hippocampus of CUS rats was quantified by real-time PCR (Fig. 4F). One-way ANOVA identified significant group differences in the gene expression of Ki67 (F3,26 = 14.778, p < 0.001), Nestin (F3,25 = 7.935, p = 0.001), and Dcx (F3,25 = 15.684, p < 0.001), but not NeuN (F3,27 = 2.943, p = 0.053). The sham-treated CUS rats showed lower gene expression of Ki67 (p = 0.001) and Dcx (p < 0.001) compared with non-CUS rats. Treatment with TES effectively restored the expression of Ki67 (p < 0.001). Moreover, the TES-treated CUS rats showed a higher expression of Nestin compared with both the sham-treated CUS rats and non-CUS rats. Treatment with TMZ abolished the upregulated expression of Ki67 and Nestin in the TES-treated CUS rats (Ki67: p = 0.001; Nestin: p = 0.018).
      A correlation analysis was conducted to examine the association between the TES-induced antidepressant-like effects and neurogenesis-related markers in the CUS rats (Fig. 4G). There was a positive correlation between Ki67 and Nestin (r = 0.551, p = 0.012), suggesting they are closely associated with hippocampal neurogenesis induced by TES. Additionally, there were positive correlations between sucrose preference and gene expression of Ki67 (r = 0.518, p = 0.040) and Nestin (r = 0.626, p = 0.016), suggesting a positive association between neurogenesis and the hedonic-like effects of TES. On the other hand, there were no correlations between immobility time in the FST and Ki67 gene expression (r = −0.314, p = n.s.) or Nestin gene expression (r = −0.410, p = n.s.), which agreed with the behavioral results that showed neurogenesis-independent anti-despair effect of TES.

      3.7 TES altered the expression of neuroplasticity-related proteins in the CUS rat model

      Neuroplasticity changes induced by chronic stress are closely associated with the pathophysiology of depression [
      • Pittenger C.
      • Duman R.S.
      Stress, depression, and neuroplasticity: a convergence of mechanisms.
      ]. We examined the effects of TES on neuroplasticity, particularly on the synaptic and apoptotic components. To this end, we examined neuroplasticity-related proteins in the hippocampus (Fig. 5A) and amygdala (Fig. 5G) of the CUS model. In the hippocampus, one-way ANOVA showed significant group changes in pAKT/AKT ratio (F2,18 = 8.136, p = 0.004; Fig. 5B), pPKA/PKA ratio (F2,20 = 0.357, p = 0.704; Fig. 5C), SYP (F2,21 = 8.172, p = 0.003; Fig. 5D), PSD95 (F2,21 = 0.111, p = 0.895, Fig. 5E), and BAX (F2,20 = 8.283, p = 0.003; Fig. 5F). The sham-treated CUS rats showed a higher pAKT/AKT ratio (p = 0.013) and a lower SYP expression (p = 0.036) compared with the non-CUS control rats, whereas TES treatment reversed these changes (pAKT/AKT: p = 0.013; SYP: p = 0.003). Moreover, TES treatment also reduced BAX expression compared with the non-CUS control rats (p = 0.038) and sham-treated rats (p = 0.003).
      Fig. 5
      Fig. 5Effects of TES on protein expression related to neuroplasticity and cell death. (A) Representative blot images of pPKA, PKA, pAKT, AKT, SYP, PSD95, and Bax in the hippocampus of CUS model. Densitometric analysis of (B) pAKT/AKT ratio, (C) pPKA/PKA ratio, (D) SYP, (E) PSD95, and (F) BAX in the hippocampus. The CUS rats exhibited increased pAKT/AKT ratio and reduced SYP expression. Administration of TES in the CUS rats normalized the stress-induced changes in pAKT/AKT ratio and SYP expression, and downregulated BAX. (G) Representative blot images of pPKA, PKA, pAKT, AKT, SYP, PSD95, and Bax in the amygdala. Densitometric analysis of (H) pAKT/AKT ratio, (I) pPKA/PKA ratio, (J) SYP, (K) PSD95, and (L) BAX in the amygdala. The CUS rats exhibited reduced pAKT/AKT ratio, pPKA/PKA ratio, and SYP expression, but elevated PSD95 and BAX levels. TES in the CUS rats significantly normalized the CUS-induced changes in pPKA/PKA ratio, and PSD95 and BAX expression. Data are presented as mean + SEM.p < 0.05; ∗∗p ≤ 0.01.
      In the amygdala, one-way ANOVA showed significant group changes in pAKT/AKT ratio (F2,18 = 6.097, p = 0.011; Fig. 5H), pPKA/PKA ratio (F2,18 = 28.687, p < 0.001; Fig. 5I), SYP (F2,16 = 11.354, p = 0.001; Fig. 5J), PSD95 (F2,17 = 10.422, p = 0.001; Fig. 5K), and BAX (F2,15 = 11.624, p = 0.001; Fig. 5L). The sham-treated CUS rats had lower pAKT/AKT ratio (p = 0.011), pPKA/PKA ratio (p < 0.001), and SYP level (p = 0.039), but elevated PSD95 (p = 0.002) and BAX expression (p = 0.002). Treatment with TES effectively reversed the CUS-induced changes on pPKA/PKA ratio (p = 0.006), PSD95 (p = 0.023) and BAX (p = 0.019). Together, these results suggest that TES induced neuroplasticity-related effects in the CUS model, potentially leading to improvements in synaptic plasticity and reduced apoptosis in the hippocampus and amygdala.

      4. Discussion

      Patients with visual impairment are more vulnerable to developing depression and anxiety [
      • Zheng Y.
      • Wu X.
      • Lin X.
      • Lin H.
      The prevalence of depression and depressive symptoms among eye disease patients: a systematic review and meta-analysis.
      ,
      • Frank C.R.
      • Xiang X.
      • Stagg B.C.
      • Ehrlich J.R.
      Longitudinal associations of self-reported vision impairment with symptoms of anxiety and depression among older adults in the United States.
      ]. To investigate whether the S334ter-line-3 rat model of retinal degeneration can develop depressive-like behaviors similar to depressive symptoms in humans, we conducted a series of behavioral tests mimicking the clinical diagnosis of depression [
      • Lim L.W.
      • Prickaerts J.
      • Huguet G.
      • Kadar E.
      • Hartung H.
      • Sharp T.
      • et al.
      Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
      ,
      Substance Abuse and Mental Health Services Administration (US)
      Managing depressive symptoms in substance abuse clients during early recovery. Managing depressive symptoms in substance abuse clients during early recovery, Rockville (MD).
      ,
      • Association A.P.
      Diagnostic and statistical manual of mental disorders (DSM-5®).
      ]. The S334ter-line-3 rats exhibited elevated anxiety levels, as demonstrated in the cylinder test, OFT, and HCET. There were no significant differences in the forced swim immobility time between the sham-treated S334ter-line-3 and control rats, which suggests the retinal degeneration model did not exhibit increased despair compared to control rats.
      The electrophysiology study in S334ter-line-3 rats showed the integrity of visual pathway from the retina to superior colliculus was preserved. The superior colliculus is a primary subcortical relay for visual information. An intact visual pathway can potentially allow the transmission of TES-induced input to visually connected brain regions, such as the limbic system [
      • McFadyen J.
      • Mattingley J.B.
      • Garrido M.I.
      An afferent white matter pathway from the pulvinar to the amygdala facilitates fear recognition.
      ,
      • Diederich N.J.
      • Stebbins G.
      • Schiltz C.
      • Goetz C.G.
      Are patients with Parkinson's disease blind to blindsight?.
      ,
      • Pessoa L.
      • Adolphs R.
      Emotion processing and the amygdala: from a'low road'to'many roads' of evaluating biological significance.
      ,
      • Tsanov M.
      • Manahan-Vaughan D.
      Synaptic plasticity from visual cortex to hippocampus: systems integration in spatial information processing.
      ,
      • Suzuki W.A.
      • Amaral D.G.
      Topographic organization of the reciprocal connections between the monkey entorhinal cortex and the perirhinal and parahippocampal cortices.
      ]. In S334ter-line-3 rats, TES significantly ameliorated anxiety-like behaviors as indicated by the cylinder test, OFT, and HCET. Surprisingly, despite the lack of despair-like behavior in the sham-treated S334ter-line-3 rats, TES at 100 and 200 μA significantly decreased immobility time in the FST, implying an anti-despair-like effect of TES. In the control rats, TES did not generally lead to pronounced behavioral changes, except TES at 100 μA, which increased rearing in the cylinder test and decreased the distance traveled in the OFT. Overall, the effects of TES on control rats were inconclusive, as TES at 200 and 500 μA did not induce significant changes in all anxiety- and depression-related behavioral parameters.
      Comparing the effects of different stimulation amplitudes, we found that TES at 100 and 200 μA elicited the most profound anxiolytic effects in S334ter-line-3 rats in all behavioral tests, whereas TES at 500 μA failed to induce significant improvements in the OFT and FST. These findings are in agreement with a study investigating the optimal neuroprotective parameters of TES [
      • Morimoto T.
      • Miyoshi T.
      • Sawai H.
      • Fujikado T.
      Optimal parameters of transcorneal electrical stimulation (TES) to be neuroprotective of axotomized RGCs in adult rats.
      ], which showed repeated administration of 30–60 min of TES at 100 or 200 μA amplitude, 1 or 2 ms pulse width, and 20 Hz frequency induced the most beneficial effects by enhancing the survival of axotomized retinal ganglion cells in rats. Together with their findings, our current study suggested that TES at a moderate intensity of 100 or 200 μA was optimal for relieving ophthalmological or mental disorders in rats.
      We compared the retinal histology between the TES and sham-treated groups to determine whether TES can rescue the degenerated retinal layers in S334ter-line-3 model. In agreement with previous findings [
      • Chen K.
      • Wang Y.
      • Liang X.
      • Zhang Y.
      • Ng T.K.
      • Chan L.L.
      Electrophysiology alterations in primary visual cortex neurons of retinal degeneration (S334ter-line-3) rats.
      ], we found that S334ter-line-3 rats had significantly thinner retinas with a loss of photoreceptor layers compared to age-matched controls. The histological assessment of degenerated retinas showed that TES at all tested amplitudes was unable to rescue the atrophied retinas. Previous studies showed the photoreceptor degeneration in the S334ter-line-3 rat model begins as early as P15, whereas significant thinning of the outer nuclear layer becomes apparent by P60 with only a single row of photoreceptors remaining [
      • Ray A.
      • Sun G.J.
      • Chan L.
      • Grzywacz N.M.
      • Weiland J.
      • Lee E.-J.
      Morphological alterations in retinal neurons in the S334ter-line3 transgenic rat.
      ]. Given the inherent progressive retinal degeneration in S334ter-line-3 rats, our TES treatment might not be optimal or fall within the therapeutic window to rescue the retinas, as we started the TES treatment at 10 weeks. Another possible explanation is that the retinas were already too deteriorated before TES was applied. As the retinal thickness is generally correlated with a decline in retinal and visual functions [
      • Sandberg M.A.
      • Brockhurst R.J.
      • Gaudio A.R.
      • Berson E.L.
      The association between visual acuity and central retinal thickness in retinitis pigmentosa.
      ,
      • Forooghian F.
      • Stetson P.F.
      • Meyer S.A.
      • Chew E.Y.
      • Wong W.T.
      • Cukras C.
      • et al.
      Relationship between photoreceptor outer segment length and visual acuity in diabetic macular edema.
      ,
      • Patel A.K.
      • Akinsoji E.
      • Hackam A.S.
      Defining the relationships among retinal function, layer thickness and visual behavior during oxidative stress-induced retinal degeneration.
      ], our results imply that TES did not enhance visual ability in S334ter-line-3 rats, and therefore the behavioral improvements observed were mediated through non-visual components.
      The promising behavioral results in the retinal degeneration model prompted us to examine further the antidepressant-like effects and the underlying mechanisms of TES using the CUS rat model. The TES treatment was applied at 200 μA based on its promising antidepressant-like effects in S334ter-line-3 rats (Fig. 1), and on previous findings that identified TES at 200 μA was more potent than at 100 μA in promoting the expression of neurotrophins and normalizing apoptotic factors [
      • Tao Y.
      • Chen T.
      • Liu Z.-Y.
      • Wang L.-Q.
      • Xu W.-W.
      • Qin L.-M.
      • et al.
      Topographic quantification of the transcorneal electrical stimulation (TES)–Induced protective effects on N-methyl-N-Nitrosourea–Treated retinas.
      ]. We showed that TES at 200 μA counteracted the CUS-induced anhedonia- and despair-like responses, which are the core symptoms of depression in humans [
      • Association A.P.
      Diagnostic and statistical manual of mental disorders (DSM-5®).
      ]. As we did not observe conclusive antidepressant-like effects of TES in the control groups in study 1, the effects of TES were not investigated in the non-CUS control rats. Although TES was shown to alter locomotor activity in S334ter-line-3 rats, we observed a comparable locomotor ability in the CUS model regardless of the TES treatment as measured by the distance traveled, which should eliminate any confounding effects of locomotion on the behavioral performance.
      It is widely recognized that chronic stress disrupts neuroplasticity and plays a vital role in the development of depression, whereas antidepressants exert opposite effects by enhancing neuroplasticity [
      • Pittenger C.
      • Duman R.S.
      Stress, depression, and neuroplasticity: a convergence of mechanisms.
      ]. We assessed the effects of TES on different aspects of neuroplasticity, including neurogenesis, synaptic plasticity, and apoptosis. Our findings are concordant with previous studies that reported a reduction in hippocampal neurogenesis in the CUS model, as determined by lower expression of Ki67 and DCX, which are markers of proliferating cells and immature neurons, respectively [
      • Kumar S.
      • Mondal A.C.
      Neuroprotective, neurotrophic and anti-oxidative role of Bacopa monnieri on CUS induced model of depression in rat.
      ,
      • Zhang Z.
      • Wang W.
      • Zhong P.
      • Liu S.J.
      • Long J.Z.
      • Zhao L.
      • et al.
      Blockade of 2-arachidonoylglycerol hydrolysis produces antidepressant-like effects and enhances adult hippocampal neurogenesis and synaptic plasticity.
      ,
      • Conboy L.
      • Varea E.
      • Castro J.E.
      • Sakouhi-Ouertatani H.
      • Calandra T.
      • Lashuel H.A.
      • et al.
      Macrophage migration inhibitory factor is critically involved in basal and fluoxetine-stimulated adult hippocampal cell proliferation and in anxiety, depression, and memory-related behaviors.
      ]. The neurogenic role of TES was evident by the upregulation of Ki67 and Nestin, a commonly used marker of neuronal progenitor cells [
      • Sun F.-L.
      • Wang W.
      • Zuo W.
      • Xue J.-L.
      • Xu J-d
      • Ai H.-X.
      • et al.
      Promoting neurogenesis via Wnt/β-catenin signaling pathway accounts for the neurorestorative effects of morroniside against cerebral ischemia injury.
      ], in the hippocampus of TES-treated rats. However, the expression of Dcx and Neun, a marker of mature neurons [
      • Chen Y.C.
      • Shi L.
      • Zhu G.Y.
      • Wang X.
      • Liu D.F.
      • Liu Y.Y.
      • et al.
      Effects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats.
      ], were not significantly altered by TES. One possible reason is that neuronal progenitor cells in adult rat hippocampus generally take 3–5 weeks to differentiate and mature [
      • Kohler S.J.
      • Williams N.I.
      • Stanton G.B.
      • Cameron J.L.
      • Greenough W.T.
      Maturation time of new granule cells in the dentate gyrus of adult macaque monkeys exceeds six months.
      ], whereas the newly formed cells in the present study were in an earlier stage of proliferation and therefore had yet to express Dcx and Neun when animals were sacrificed. The gene expression study suggested that the antidepressant-like effects of TES may involve a neurogenesis mechanism. Treatment with TMZ abolished TES-induced hedonic-like effect, but not the anti-despair-like effect, suggesting that TES induced both neurogenesis-dependent and -independent effects, respectively. The neurogenesis-dependent hedonic effect of TES was supported by the positive correlations between sucrose preference and the expression of Ki67 and Nestin genes. On the other hand, the neurogenesis-independent anti-despair-like effect of TES was supported by the lack of correlation between forced swim immobility time and Ki67 or Nestin expression. However, it should be noted that the use of TMZ as a blocking agent for cell proliferation not only inhibits neurogenesis, but may also suppress proliferating glial cells. The results from our study cannot eliminate the involvement of a gliogenic effect by TES. In particular, ki67 and nestin are expressed in both neuronal and glial progenitor cells [
      • Wiese C.
      • Rolletschek A.
      • Kania G.
      • Blyszczuk P.
      • Tarasov K.
      • Tarasova Y.
      • et al.
      Nestin expression–a property of multi-lineage progenitor cells?.
      ]. Although nestin expression is typically restricted to neuronal progenitors under physiological conditions, previous research showed that neuroinflammatory insults, including under chronic stress, could increase microglial proliferation and shift nestin expression towards activated microglia/macrophages [
      • Krishnasamy S.
      • Weng Y.-C.
      • Thammisetty S.S.
      • Phaneuf D.
      • Lalancette-Hebert M.
      • Kriz J.
      Molecular imaging of nestin in neuroinflammatory conditions reveals marked signal induction in activated microglia.
      ,
      • de Pablos R.M.
      • Herrera A.J.
      • Espinosa-Oliva A.M.
      • Sarmiento M.
      • Muñoz M.F.
      • Machado A.
      • et al.
      Chronic stress enhances microglia activation and exacerbates death of nigral dopaminergic neurons under conditions of inflammation.
      ]. This might suggest that nestin could act as a marker of inflammatory responses. Nevertheless, the expression of Ki67 and Nestin reported in our current study were unlikely to be derived from neuroinflammation or microglial proliferation as we did not observe an increase in Ki67 and Nestin after CUS. Furthermore, earlier findings demonstrated an anti-inflammatory role of TES through suppressing microglial activation [
      • Fu L.
      • Fung F.K.
      • Lo A.C.-Y.
      • Chan Y.-K.
      • So K.-F.
      • Wong I.Y.-H.
      • et al.
      Transcorneal electrical stimulation inhibits retinal microglial activation and enhances retinal ganglion cell survival after acute ocular hypertensive injury.
      ,
      • Yin H.
      • Yin H.
      • Zhang W.
      • Miao Q.
      • Qin Z.
      • Guo S.
      • et al.
      Transcorneal electrical stimulation promotes survival of retinal ganglion cells after optic nerve transection in rats accompanied by reduced microglial activation and TNF-α expression.
      ,
      • Jassim A.H.
      • Cavanaugh M.
      • Shah J.S.
      • Willits R.
      • Inman D.M.
      Transcorneal electrical stimulation reduces neurodegenerative process in a mouse model of glaucoma.
      ,
      • Zhou W-t
      • Ni Y-q
      • Jin Z-b
      • Zhang M.
      • Wu J-h
      • Zhu Y.
      • et al.
      Electrical stimulation ameliorates light-induced photoreceptor degeneration in vitro via suppressing the proinflammatory effect of microglia and enhancing the neurotrophic potential of Müller cells.
      ]. The upregulation of Ki67 and Nestin expression after TES treatment in our study favor a neurogenic effect instead of a glial-mediated inflammatory effects. However, further studies are needed to investigate whether glial cells or gliogenesis play a role in the antidepressant-like effects of TES.
      Depressed patients and animal models consistently show a dysfunctional hypothalamic-pituitary-adrenal (HPA) axis, as shown by elevated circulating glucocorticoid levels [
      • Liu D.
      • Xie K.
      • Yang X.
      • Gu J.
      • Ge L.
      • Wang X.
      • et al.
      Resveratrol reverses the effects of chronic unpredictable mild stress on behavior, serum corticosterone levels and BDNF expression in rats.
      ,
      • Raone A.
      • Cassanelli A.
      • Scheggi S.
      • Rauggi R.
      • Danielli B.
      • De Montis M.
      Hypothalamus–pituitary–adrenal modifications consequent to chronic stress exposure in an experimental model of depression in rats.
      ,
      • Lehmann M.L.
      • Mustafa T.
      • Eiden A.M.
      • Herkenham M.
      • Eiden L.E.
      PACAP-deficient mice show attenuated corticosterone secretion and fail to develop depressive behavior during chronic social defeat stress.
      ,
      • Keller J.
      • Gomez R.
      • Williams G.
      • Lembke A.
      • Lazzeroni L.
      • Murphy G.M.
      • et al.
      HPA axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition.
      ,
      • Markopoulou K.
      • Papadopoulos A.
      • Juruena M.F.
      • Poon L.
      • Pariante C.M.
      • Cleare A.J.
      The ratio of cortisol/DHEA in treatment resistant depression.
      ]. On the other hand, antidepressant drugs can also normalize glucocorticoid secretions [
      • Yau J.L.
      • Noble J.
      • Thomas S.
      • Kerwin R.
      • Morgan P.E.
      • Lightman S.
      • et al.
      The antidepressant desipramine requires the ABCB1 (Mdr1)-type p-glycoprotein to upregulate the glucocorticoid receptor in mice.
      ,
      • Hinkelmann K.
      • Moritz S.
      • Botzenhardt J.
      • Muhtz C.
      • Wiedemann K.
      • Kellner M.
      • et al.
      Changes in cortisol secretion during antidepressive treatment and cognitive improvement in patients with major depression: a longitudinal study.
      ,
      • Piwowarska J.
      • Chimiak A.
      • Matsumoto H.
      • Dziklińska A.
      • Radziwoń-Zaleska M.
      • Szelenberger W.
      • et al.
      Serum cortisol concentration in patients with major depression after treatment with fluoxetine.
      ,
      • de Sousa Tomaz V.
      • Chaves Filho A.J.M.
      • Cordeiro R.C.
      • Jucá P.M.
      • Soares M.V.R.
      • Barroso P.N.
      • et al.
      Antidepressants of different classes cause distinct behavioral and brain pro-and anti-inflammatory changes in mice submitted to an inflammatory model of depression.
      ]. To this end, we investigated plasma corticosterone level in the CUS rats, which showed higher plasma corticosterone indicating a state of stress and dysregulated HPA axis. Treatment with TES effectively attenuated the stress-induced rise in corticosterone levels, suggesting the antidepressant-like effects of TES might involve normalization of the HPA axis. It has been reported that animals with depleted neurogenesis by TMZ or radiation treatments have higher corticosterone levels, likely due to the loss of a stress response buffering system in the newly formed hippocampal granule neurons [
      • Egeland M.
      • Guinaudie C.
      • Du Preez A.
      • Musaelyan K.
      • Zunszain P.
      • Fernandes C.
      • et al.
      Depletion of adult neurogenesis using the chemotherapy drug temozolomide in mice induces behavioural and biological changes relevant to depression.
      ,
      • Snyder J.S.
      • Soumier A.
      • Brewer M.
      • Pickel J.
      • Cameron H.A.
      Adult hippocampal neurogenesis buffers stress responses and depressive behaviour.
      ]. However, in the current study, the TMZ + TES-treated CUS rats did not show significantly higher corticosterone levels compared to sham-treated CUS rats, suggesting that TES can reduce corticosterone levels regardless of the presence of a neurogenesis blocker.
      In depression, stress is reported to alter synaptic plasticity and apoptosis in the hippocampus and amygdala [
      • Pittenger C.
      • Duman R.S.
      Stress, depression, and neuroplasticity: a convergence of mechanisms.
      ,
      • Boyle L.M.
      A neuroplasticity hypothesis of chronic stress in the basolateral amygdala.
      ,
      • Liu W.
      • Ge T.
      • Leng Y.
      • Pan Z.
      • Fan J.
      • Yang W.
      • et al.
      The role of neural plasticity in depression: from hippocampus to prefrontal cortex.
      ,
      • Kosten T.A.
      • Galloway M.P.
      • Duman R.S.
      • Russell D.S.
      • D'sa C.
      Repeated unpredictable stress and antidepressants differentially regulate expression of the bcl-2 family of apoptotic genes in rat cortical, hippocampal, and limbic brain structures.
      ,
      • Ding L.
      • Zhang C.
      • Masood A.
      • Li J.
      • Sun J.
      • Nadeem A.
      • et al.
      Protective effects of phosphodiesterase 2 inhibitor on depression-and anxiety-like behaviors: involvement of antioxidant and anti-apoptotic mechanisms.
      ,
      • Colla A.R.
      • Pazini F.L.
      • Lieberknecht V.
      • Camargo A.
      • Rodrigues A.L.S.
      Ursolic acid abrogates depressive-like behavior and hippocampal pro-apoptotic imbalance induced by chronic unpredictable stress.
      ]. The hippocampus and amygdala have functional connections with the cortical visual pathway and subcortical retinotectal pathway, and hence, are also implicated in the processing of visual emotional stimuli. Similar to previous reports [
      • Zhang L.
      • Luo J.
      • Zhang M.
      • Yao W.
      • Ma X.
      • Yu S.Y.
      Effects of curcumin on chronic, unpredictable, mild, stress-induced depressive-like behaviour and structural plasticity in the lateral amygdala of rats.
      ,
      • Kang J.
      • Wang Y.
      • Wang D.
      Endurance and resistance training mitigate the negative consequences of depression on synaptic plasticity through different molecular mechanisms.
      ,
      • Luo J.
      • Zhang L.
      • Ning N.
      • Jiang H.
      • Yu S.Y.
      Neotrofin reverses the effects of chronic unpredictable mild stress on behavior via regulating BDNF, PSD-95 and synaptophysin expression in rat.
      ,
      • Ma H.
      • Li C.
      • Wang J.
      • Zhang X.
      • Li M.
      • Zhang R.
      • et al.
      Amygdala-hippocampal innervation modulates stress-induced depressive-like behaviors through AMPA receptors.
      ,
      • Woodburn S.C.
      • Bollinger J.L.
      • Wohleb E.S.
      Synaptic and behavioral effects of chronic stress are linked to dynamic and sex-specific changes in microglia function and astrocyte dystrophy.
      ], we identified synaptic dysfunctions in the CUS model, as demonstrated by a significant decrease in the presynaptic marker SYP in both the hippocampus and amygdala, and an increase in the postsynaptic marker PSD95 in the amygdala. We found that TES in the CUS rats effectively normalized the expression of SYP and PSD95 in the hippocampus and amygdala, respectively, suggesting that TES may induce a synaptic effect that contributes to the antidepressant-like responses. Moreover, we found that the expression of a pro-apoptotic marker Bax was downregulated by TES in the CUS animals, suggesting a potential anti-apoptotic mechanism of TES. This agrees with previous studies that showed Bax was downregulated by TES in the retina [
      • Ni Y-q
      • Gan D-k
      • Xu H-d
      • Xu G-z
      Neuroprotective effect of transcorneal electrical stimulation on light-induced photoreceptor degeneration.
      ,
      • Willmann G.
      • Schäferhoff K.
      • Fischer M.D.
      • Arango-Gonzalez B.
      • Bolz S.
      • Naycheva L.
      • et al.
      Gene expression profiling of the retina after transcorneal electrical stimulation in wild-type Brown Norway rats.
      ] and by antidepressants in the CUS animals [
      • Ding L.
      • Zhang C.
      • Masood A.
      • Li J.
      • Sun J.
      • Nadeem A.
      • et al.
      Protective effects of phosphodiesterase 2 inhibitor on depression-and anxiety-like behaviors: involvement of antioxidant and anti-apoptotic mechanisms.
      ,
      • Colla A.R.
      • Pazini F.L.
      • Lieberknecht V.
      • Camargo A.
      • Rodrigues A.L.S.
      Ursolic acid abrogates depressive-like behavior and hippocampal pro-apoptotic imbalance induced by chronic unpredictable stress.
      ]. Both AKT and PKA signaling pathways are implicated in neuroplasticity [
      • Duman R.S.
      • Voleti B.
      Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents.
      ,
      • Kitagishi Y.
      • Kobayashi M.
      • Kikuta K.
      • Matsuda S.
      Roles of PI3K/AKT/GSK3/mTOR pathway in cell signaling of mental illnesses.
      ,
      • Marsden W.
      Synaptic plasticity in depression: molecular, cellular and functional correlates.
      ,
      • Dagda R.K.
      • Banerjee T.D.
      Role of protein kinase A in regulating mitochondrial function and neuronal development: implications to neurodegenerative diseases.
      ]. The kinase AKT regulates synaptic plasticity and neuronal apoptosis and is widely expressed in emotional circuits, including the hippocampus and amygdala. Although AKT activity was found to be decreased by stress and depression, various stress models have reported the opposite, with higher pAKT levels found in the hippocampus and amygdala [
      • Eagle A.L.
      • Knox D.
      • Roberts M.M.
      • Mulo K.
      • Liberzon I.
      • Galloway M.P.
      • et al.
      Single prolonged stress enhances hippocampal glucocorticoid receptor and phosphorylated protein kinase B levels.
      ,
      • Yang P.-C.
      • Yang C.-H.
      • Huang C.-C.
      • Hsu K.-S.
      Phosphatidylinositol 3-kinase activation is required for stress protocol-induced modification of hippocampal synaptic plasticity.
      ,
      • Lee S.Y.
      • Kang J.S.
      • Song G.Y.
      • Myung C.-S.
      Stress induces the expression of heterotrimeric G protein β subunits and the phosphorylation of PKB/Akt and ERK1/2 in rat brain.
      ]. In our study, the CUS rats exhibited increased hippocampal AKT activity, which was normalized by TES treatment, suggesting the beneficial effects of TES may involve the modulation of AKT signaling. In addition, we observed reduced PKA activity in the amygdala, as indicated by a lower pPKA/PKA ratio. As a major regulator of many cyclic adenosine monophosphate-dependent biological processes, PKA plays a pivotal role in neuronal survival and synaptic plasticity [
      • Dwivedi Y.
      • Pandey G.N.
      Adenylyl cyclase-cyclicAMP signaling in mood disorders: role of the crucial phosphorylating enzyme protein kinase A.
      ]. Reduction of PKA in the amygdala has been demonstrated in a social defeat stress model of depression [
      • Chen P.
      • Fan Y.
      • Li Y.
      • Sun Z.
      • Bissette G.
      • Zhu M.-Y.
      Chronic social defeat up-regulates expression of norepinephrine transporter in rat brains.
      ] and postmortem brains of depressed patients [
      • Shelton R.C.
      • Hal Manier D.
      • Lewis D.A.
      Protein kinases A and C in post-mortem prefrontal cortex from persons with major depression and normal controls.
      ]. Not surprisingly, antidepressants can enhance PKA activation in the amygdala of rats [
      • Réus G.Z.
      • Stringari R.B.
      • Ribeiro K.F.
      • Ferraro A.K.
      • Vitto M.F.
      • Cesconetto P.
      • et al.
      Ketamine plus imipramine treatment induces antidepressant-like behavior and increases CREB and BDNF protein levels and PKA and PKC phosphorylation in rat brain.
      ]. Furthermore, anxiety-like behaviors in the social defeat stress model were alleviated by a PKA activator and aggravated by a PKA inhibitor administered in the amygdala [
      • Yang L.
      • Shi L.-J.
      • Yu J.
      • Zhang Y.-Q.
      Activation of protein kinase A in the amygdala modulates anxiety-like behaviors in social defeat exposed mice.
      ]. Our finding that TES restored PKA activity in the amygdala of CUS model agrees with the abovementioned studies, suggesting a role of PKA signaling in the amygdala on the effects of TES.
      Fig. 6 illustrates a hypothetical model summarizing the antidepressant-like effects of TES. We hypothesized that TES elicits its effects on the hippocampus and amygdala through functional connections between cortical and subcortical visual pathways [
      • McFadyen J.
      • Mattingley J.B.
      • Garrido M.I.
      An afferent white matter pathway from the pulvinar to the amygdala facilitates fear recognition.
      ,
      • Diederich N.J.
      • Stebbins G.
      • Schiltz C.
      • Goetz C.G.
      Are patients with Parkinson's disease blind to blindsight?.
      ,
      • Pessoa L.
      • Adolphs R.
      Emotion processing and the amygdala: from a'low road'to'many roads' of evaluating biological significance.
      ,
      • Tsanov M.
      • Manahan-Vaughan D.
      Synaptic plasticity from visual cortex to hippocampus: systems integration in spatial information processing.
      ,
      • Suzuki W.A.
      • Amaral D.G.
      Topographic organization of the reciprocal connections between the monkey entorhinal cortex and the perirhinal and parahippocampal cortices.
      ], and that the normalization of corticosterone is associated with limbic regulation of the HPA axis by the hippocampus and amygdala via the paraventricular nucleus [
      • Jankord R.
      • Herman J.P.
      Limbic regulation of hypothalamo-pituitary-adrenocortical function during acute and chronic stress.
      ,
      • van Bodegom M.
      • Homberg J.R.
      • Henckens M.J.
      Modulation of the hypothalamic-pituitary-adrenal axis by early life stress exposure.
      ,
      • Pittman Q.
      • Blume H.
      • Renaud L.
      Connections of the hypothalamic paraventricular nucleus with the neurohypophysis, median eminence, amygdala, lateral septum and midbrain periaqueductal gray: an electrophysiological study in the rat.
      ]. These molecular changes induced by TES treatment eventually translate into the antidepressant-like behaviors observed in the CUS rat model.
      Fig. 6
      Fig. 6Proposed model of the antidepressant-like effects by TES. We hypothesized that TES exerts its effects on the hippocampus and amygdala via cortical (solid line) and subcortical (dotted line) visual pathways, resulting in the observed gene and protein expression changes. The hippocampus and amygdala have regulatory roles in the HPA axis (dashed line), which normalize glucocorticoid secretions. The TES-induced molecular changes lead to antidepressant-like behaviors, including increased sucrose preference and reduced forced swim immobility. Amy: amygdala; EC: entorhinal Cortex; Hipp: hippocampus; HPA: hypothalamic–pituitary–adrenal; LGN: lateral geniculate nucleus; LP - lateral posterior thalamic nucleus; PVN: paraventricular nucleus; SC: superior colliculus; VC: visual cortex. This figure was created using the BioRender.com software.

      5. Conclusion

      Our study showed that TES can induce antidepressant-like effects in S334ter-line-3 and CUS rats. Results from the CUS model highlight the antidepressant-like effects of TES possibly act through the normalization of plasma corticosterone and modulation of neuroplasticity within the hippocampus and amygdala involving neurogenesis, synaptic plasticity, and neuronal apoptosis. Other factors contributing to the antidepressant effects of TES remain an interesting topic that warrants further study.

      Statement of ethics

      All procedures were approved by the Committee on the Use of Live Animals in Teaching and Research of the University of Hong Kong (Ref.: 4945-19).

      CRediT authorship contribution statement

      Wing Shan Yu: Data curation, Formal analysis, Investigation, Visualization, Methodology, and Drafting/Editing/Revising the Manuscript. Anna Chung-Kwan Tse: Investigation, Methodology. Li Guan: Investigation, Methodology. Jennifer Lok Yu Chiu: Investigation, Methodology. Shawn Zheng Kai Tan: Investigation, Methodology. Sharafuddin Khairuddin: Investigation, Methodology. Stephen Kugbere Agadagba: Investigation, Methodology. Amy Cheuk Yin Lo: Investigation, Methodology. Man-Lung Fung: Investigation, Methodology. Ying-Shing Chan: Investigation, Methodology. Leanne Lai Hang Chan: Conceptualization, Resources, Validation, Investigation. Lee Wei Lim: Conceptualization and Design, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Project administration, and Drafting/Editing/Revising the Manuscript. All authors have read, commented and approved the final content of the manuscript.

      Declaration of competing interest

      The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

      Acknowledgments and funding sources

      The scientific works were funded by General Research Fund of the Hong Kong Research Grants Council (Ref.: 17119420 ) and research funding from the University of Hong Kong (Seed Fund for Basic Research, Ref.: 201811159133 ; and Seed Fund for Translational & Applied Research, Ref.: 201910160010 ) awarded to Lee Wei Lim. The experiments were conducted at the Neuromodulation Laboratory (www.drlimlab.com), except for the electrophysiology study which was performed at the City University of Hong Kong. The authors thank Ms Shi Qi Liang for assisting the S334terline-3 experiment.

      References

        • Wang J.
        • Wu X.
        • Lai W.
        • Long E.
        • Zhang X.
        • Li W.
        • et al.
        Prevalence of depression and depressive symptoms among outpatients: a systematic review and meta-analysis.
        BMJ Open. 2017; 7e017173
        • Zheng Y.
        • Wu X.
        • Lin X.
        • Lin H.
        The prevalence of depression and depressive symptoms among eye disease patients: a systematic review and meta-analysis.
        Sci Rep. 2017; 7: 46453
        • Frank C.R.
        • Xiang X.
        • Stagg B.C.
        • Ehrlich J.R.
        Longitudinal associations of self-reported vision impairment with symptoms of anxiety and depression among older adults in the United States.
        JAMA ophthalmol. 2019; 137: 793-800
        • McFadyen J.
        • Mattingley J.B.
        • Garrido M.I.
        An afferent white matter pathway from the pulvinar to the amygdala facilitates fear recognition.
        Elife. 2019; 8e40766
        • Diederich N.J.
        • Stebbins G.
        • Schiltz C.
        • Goetz C.G.
        Are patients with Parkinson's disease blind to blindsight?.
        Brain. 2014; 137: 1838-1849
        • Pessoa L.
        • Adolphs R.
        Emotion processing and the amygdala: from a'low road'to'many roads' of evaluating biological significance.
        Nat Rev Neurosci. 2010; 11: 773-782
        • Tsanov M.
        • Manahan-Vaughan D.
        Synaptic plasticity from visual cortex to hippocampus: systems integration in spatial information processing.
        Neuroscientist. 2008; 14: 584-597
        • Suzuki W.A.
        • Amaral D.G.
        Topographic organization of the reciprocal connections between the monkey entorhinal cortex and the perirhinal and parahippocampal cortices.
        J Neurosci. 1994; 14: 1856-1877
        • Xie J.
        • Wang G.-J.
        • Yow L.
        • Cela C.J.
        • Humayun M.S.
        • Weiland J.D.
        • et al.
        Modeling and percept of transcorneal electrical stimulation in humans.
        IEEE (Inst Electr Electron Eng) Trans Biomed Eng. 2011; 58: 1932-1939
        • Morimoto T.
        • Miyoshi T.
        • Matsuda S.
        • Tano Y.
        • Fujikado T.
        • Fukuda Y.
        Transcorneal electrical stimulation rescues axotomized retinal ganglion cells by activating endogenous retinal IGF-1 system.
        Investig Ophthalmol Vis Sci. 2005; 46: 2147-2155
        • Morimoto T.
        • Miyoshi T.
        • Sawai H.
        • Fujikado T.
        Optimal parameters of transcorneal electrical stimulation (TES) to be neuroprotective of axotomized RGCs in adult rats.
        Exp Eye Res. 2010; 90: 285-291
        • Tagami Y.
        • Kurimoto T.
        • Miyoshi T.
        • Morimoto T.
        • Sawai H.
        • Mimura O.
        Axonal regeneration induced by repetitive electrical stimulation of crushed optic nerve in adult rats.
        Jpn J Ophthalmol. 2009; 53: 257-266
        • Henrich-Noack P.
        • Lazik S.
        • Sergeeva E.
        • Wagner S.
        • Voigt N.
        • Prilloff S.
        • et al.
        Transcorneal alternating current stimulation after severe axon damage in rats results in “long-term silent survivor” neurons.
        Brain Res Bull. 2013; 95: 7-14
        • Henrich-Noack P.
        • Voigt N.
        • Prilloff S.
        • Fedorov A.
        • Sabel B.A.
        Transcorneal electrical stimulation alters morphology and survival of retinal ganglion cells after optic nerve damage.
        Neurosci Lett. 2013; 543: 1-6
        • Miyake K-i
        • Yoshida M.
        • Inoue Y.
        • Hata Y.
        Neuroprotective effect of transcorneal electrical stimulation on the acute phase of optic nerve injury.
        Investig Ophthalmol Vis Sci. 2007; 48: 2356-2361
        • Osako T.
        • Chuman H.
        • Maekubo T.
        • Ishiai M.
        • Kawano N.
        • Nao-i N.
        Effects of steroid administration and transcorneal electrical stimulation on the anatomic and electrophysiologic deterioration of nonarteritic ischemic optic neuropathy in a rodent model.
        Jpn J Ophthalmol. 2013; 57: 410-415
        • Wang X.
        • Mo X.
        • Li D.
        • Wang Y.
        • Fang Y.
        • Rong X.
        • et al.
        Neuroprotective effect of transcorneal electrical stimulation on ischemic damage in the rat retina.
        Exp Eye Res. 2011; 93: 753-760
        • Fu L.
        • Fung F.K.
        • Lo A.C.-Y.
        • Chan Y.-K.
        • So K.-F.
        • Wong I.Y.-H.
        • et al.
        Transcorneal electrical stimulation inhibits retinal microglial activation and enhances retinal ganglion cell survival after acute ocular hypertensive injury.
        Trans Vis Sci Technol. 2018; 7: 7
        • Morimoto T.
        • Fujikado T.
        • Choi J.-S.
        • Kanda H.
        • Miyoshi T.
        • Fukuda Y.
        • et al.
        Transcorneal electrical stimulation promotes the survival of photoreceptors and preserves retinal function in royal college of surgeons rats.
        Investig Ophthalmol Vis Sci. 2007; 48: 4725-4732
        • Morimoto T.
        • Kanda H.
        • Kondo M.
        • Terasaki H.
        • Nishida K.
        • Fujikado T.
        Transcorneal electrical stimulation promotes survival of photoreceptors and improves retinal function in rhodopsin P347L transgenic rabbits.
        Investig Ophthalmol Vis Sci. 2012; 53: 4254-4261
        • Rahmani S.
        • Bogdanowicz L.
        • Thomas J.
        • Hetling J.R.
        Chronic delivery of low-level exogenous current preserves retinal function in pigmented P23H rat.
        Vis Res. 2013; 76: 105-113
        • Ni Y-q
        • Gan D-k
        • Xu H-d
        • Xu G-z
        Neuroprotective effect of transcorneal electrical stimulation on light-induced photoreceptor degeneration.
        Exp Neurol. 2009; 219: 439-452
        • Schatz A.
        • Röck T.
        • Naycheva L.
        • Willmann G.
        • Wilhelm B.
        • Peters T.
        • et al.
        Transcorneal electrical stimulation for patients with retinitis pigmentosa: a prospective, randomized, sham-controlled exploratory study.
        Investig Ophthalmol Vis Sci. 2011; 52: 4485-4496
        • Schatz A.
        • Pach J.
        • Gosheva M.
        • Naycheva L.
        • Willmann G.
        • Wilhelm B.
        • et al.
        Transcorneal electrical stimulation for patients with retinitis pigmentosa: a prospective, randomized, sham-controlled follow-up study over 1 year.
        Investig Ophthalmol Vis Sci. 2017; 58: 257-269
        • Naycheva L.
        • Schatz A.
        • Willmann G.
        • Bartz-Schmidt K.U.
        • Zrenner E.
        • Röck T.
        • et al.
        Transcorneal electrical stimulation in patients with retinal artery occlusion: a prospective, randomized, sham-controlled pilot study.
        Ophthalmol therap. 2013; 2: 25-39
        • Inomata K.
        • Shinoda K.
        • Ohde H.
        • Tsunoda K.
        • Hanazono G.
        • Kimura I.
        • et al.
        Transcorneal electrical stimulation of retina to treat longstanding retinal artery occlusion.
        Graefes Arch Clin Exp Ophthalmol. 2007; 245: 1773-1780
        • Oono S.
        • Kurimoto T.
        • Kashimoto R.
        • Tagami Y.
        • Okamoto N.
        • Mimura O.
        Transcorneal electrical stimulation improves visual function in eyes with branch retinal artery occlusion.
        Clin Ophthalmol. 2011; 5: 397
        • Fujikado T.
        • Morimoto T.
        • Matsushita K.
        • Shimojo H.
        • Okawa Y.
        • Tano Y.
        Effect of transcorneal electrical stimulation in patients with nonarteritic ischemic optic neuropathy or traumatic optic neuropathy.
        Jpn J Ophthalmol. 2006; 50: 266-273
        • Yu W.-S.
        • Kwon S.-H.
        • Agadagba S.K.
        • Chan L.-L.-H.
        • Wong K.-H.
        • Lim L.-W.
        Neuroprotective effects and therapeutic potential of transcorneal electrical stimulation for depression.
        Cells. 2021; 10: 2492
        • Albertini G.
        • Walrave L.
        • Demuyser T.
        • Massie A.
        • De Bundel D.
        • Smolders I.
        6 Hz corneal kindling in mice triggers neurobehavioral comorbidities accompanied by relevant changes in c-Fos immunoreactivity throughout the brain.
        Epilepsia. 2018; 59: 67-78
        • Koshal P.
        • Kumar P.
        Effect of liraglutide on corneal kindling epilepsy induced depression and cognitive impairment in mice.
        Neurochem Res. 2016; 41: 1741-1750
        • Wlaź P.
        • Poleszak E.
        • Serefko A.
        • Wlaź A.
        • Rundfeldt C.
        Anxiogenic-and antidepressant-like behavior in corneally kindled rats.
        Pharmacol Rep. 2015; 67: 349-352
        • Pittenger C.
        • Duman R.S.
        Stress, depression, and neuroplasticity: a convergence of mechanisms.
        Neuropsychopharmacology. 2008; 33: 88-109
        • Huang Y.
        • Li Y.
        • Chen J.
        • Zhou H.
        • Tan S.
        Electrical stimulation elicits neural stem cells activation: new perspectives in CNS repair.
        Front Hum Neurosci. 2015; 9: 586
        • Liu A.
        • Jain N.
        • Vyas A.
        • Lim L.W.
        Ventromedial prefrontal cortex stimulation enhances memory and hippocampal neurogenesis in the middle-aged rats.
        Elife. 2015; 4e04803
        • Bambico F.R.
        • Bregman T.
        • Diwan M.
        • Li J.
        • Darvish-Ghane S.
        • Li Z.
        • et al.
        Neuroplasticity-dependent and -independent mechanisms of chronic deep brain stimulation in stressed rats.
        Transl Psychiatry. 2015; 5: e674
        • Chen K.
        • Wang Y.
        • Liang X.
        • Zhang Y.
        • Ng T.K.
        • Chan L.L.
        Electrophysiology alterations in primary visual cortex neurons of retinal degeneration (S334ter-line-3) rats.
        Sci Rep. 2016; 6: 26793
        • Chen J.
        • Makino C.L.
        • Peachey N.S.
        • Baylor D.A.
        • Simon M.I.
        Mechanisms of rhodopsin inactivation in vivo as revealed by a COOH-terminal truncation mutant.
        Science. 1995; 267: 374-377
        • LaVail M.M.
        • Nishikawa S.
        • Steinberg R.H.
        • Naash M.I.
        • Duncan J.L.
        • Trautmann N.
        • et al.
        Phenotypic characterization of P23H and S334ter rhodopsin transgenic rat models of inherited retinal degeneration.
        Exp Eye Res. 2018; 167: 56-90
        • Lim L.W.
        • Prickaerts J.
        • Huguet G.
        • Kadar E.
        • Hartung H.
        • Sharp T.
        • et al.
        Electrical stimulation alleviates depressive-like behaviors of rats: investigation of brain targets and potential mechanisms.
        Transl Psychiatry. 2015; 5: e535
        • Huguet G.
        • Kadar E.
        • Temel Y.
        • Lim L.W.
        Electrical stimulation normalizes c-Fos expression in the deep cerebellar nuclei of depressive-like rats: implication of antidepressant activity.
        Cerebellum. 2017; 16: 398-410
        • Sagdullaev B.T.
        • Aramant R.B.
        • Seiler M.J.
        • Woch G.
        • McCall M.A.
        Retinal transplantation–induced recovery of retinotectal visual function in a rodent model of retinitis pigmentosa.
        Investig Ophthalmol Vis Sci. 2003; 44: 1686-1695
        • Wang Y.
        • Chen K.
        • Chan L.L.H.
        Responsive neural activities in the primary visual cortex of retina-degenerated rats.
        Neuroscience. 2018; 383: 84-97
        • Tatem K.S.
        • Quinn J.L.
        • Phadke A.
        • Yu Q.
        • Gordish-Dressman H.
        • Nagaraju K.
        Behavioral and locomotor measurements using an open field activity monitoring system for skeletal muscle diseases.
        JoVE. 2014; e51785
        • Hestermann D.
        • Temel Y.
        • Blokland A.
        • Lim L.W.
        Acute serotonergic treatment changes the relation between anxiety and HPA-axis functioning and periaqueductal gray activation.
        Behav Brain Res. 2014; 273: 155-165
        • Schatz A.
        • Arango-Gonzalez B.
        • Fischer D.
        • Enderle H.
        • Bolz S.
        • Röck T.
        • et al.
        Transcorneal electrical stimulation shows neuroprotective effects in retinas of light-exposed rats.
        Investig Ophthalmol Vis Sci. 2012; 53: 5552-5561
        • Willmann G.
        • Schäferhoff K.
        • Fischer M.D.
        • Arango-Gonzalez B.
        • Bolz S.
        • Naycheva L.
        • et al.
        Gene expression profiling of the retina after transcorneal electrical stimulation in wild-type Brown Norway rats.
        Investig Ophthalmol Vis Sci. 2011; 52: 7529-7537
        • Hiew L.F.
        • Khairuddin S.
        • Aquili L.
        • Koh J.
        • Fung M.L.
        • Lim W.L.
        • et al.
        Behavioural responses of anxiety in aversive and non-aversive conditions between young and aged Sprague-Dawley rats.
        Behav Brain Res. 2020; 385: 112559
        • Lim L.W.
        • Janssen M.L.
        • Kocabicak E.
        • Temel Y.
        The antidepressant effects of ventromedial prefrontal cortex stimulation is associated with neural activation in the medial part of the subthalamic nucleus.
        Behav Brain Res. 2015; 279: 17-21
        • Yankelevitch-Yahav R.
        • Franko M.
        • Huly A.
        • Doron R.
        The forced swim test as a model of depressive-like behavior.
        JoVE. 2015; e52587
        • Chan L.L.
        • Lee E.-J.
        • Humayun M.S.
        • Weiland J.D.
        Both electrical stimulation thresholds and SMI-32-immunoreactive retinal ganglion cell density correlate with age in S334ter line 3 rat retina.
        J Neurophysiol. 2011; 105: 2687-2697
        • Guan L.
        • Yu W.S.
        • Shrestha S.
        • Or Y.Z.
        • Lufkin T.
        • Chan Y.S.
        • et al.
        TTC9A deficiency induces estradiol-mediated changes in hippocampus and amygdala neuroplasticity-related gene expressions in female mice.
        Brain Res Bull. 2020; 157: 162-168
        • Chen Y.C.
        • Shi L.
        • Zhu G.Y.
        • Wang X.
        • Liu D.F.
        • Liu Y.Y.
        • et al.
        Effects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats.
        Brain Res. 2017; 1672: 65-72
        • Kadar E.
        • Lim L.W.
        • Carreras G.
        • Genis D.
        • Temel Y.
        • Huguet G.
        High-frequency stimulation of the ventrolateral thalamus regulates gene expression in hippocampus, motor cortex and caudate-putamen.
        Brain Res. 2011; 1391: 1-13
        • Shi M.
        • Cho H.
        • Inn K.S.
        • Yang A.
        • Zhao Z.
        • Liang Q.
        • et al.
        Negative regulation of NF-kappaB activity by brain-specific TRIpartite Motif protein 9.
        Nat Commun. 2014; 5: 4820
        • Chong P.S.
        • Khairuddin S.
        • Tse A.C.K.
        • Hiew L.F.
        • Lau C.L.
        • Tipoe G.L.
        • et al.
        Hericium erinaceus potentially rescues behavioural motor deficits through ERK-CREB-PSD95 neuroprotective mechanisms in rat model of 3-acetylpyridine-induced cerebellar ataxia.
        Sci Rep. 2020; 10: 14945
        • Chong P.S.
        • Poon C.H.
        • Roy J.
        • Tsui K.C.
        • Lew S.Y.
        • Phang M.W.L.
        • et al.
        Neurogenesis-dependent antidepressant-like activity of Hericium erinaceus in an animal model of depression.
        Chin Med. 2021; 16: 132
        • Substance Abuse and Mental Health Services Administration (US)
        Managing depressive symptoms in substance abuse clients during early recovery. Managing depressive symptoms in substance abuse clients during early recovery, Rockville (MD).
        2008
        • Association A.P.
        Diagnostic and statistical manual of mental disorders (DSM-5®).
        American Psychiatric Pub, 2013
        • Ray A.
        • Sun G.J.
        • Chan L.
        • Grzywacz N.M.
        • Weiland J.
        • Lee E.-J.
        Morphological alterations in retinal neurons in the S334ter-line3 transgenic rat.
        Cell Tissue Res. 2010; 339: 481-491
        • Sandberg M.A.
        • Brockhurst R.J.
        • Gaudio A.R.
        • Berson E.L.
        The association between visual acuity and central retinal thickness in retinitis pigmentosa.
        Investig Ophthalmol Vis Sci. 2005; 46: 3349-3354
        • Forooghian F.
        • Stetson P.F.
        • Meyer S.A.
        • Chew E.Y.
        • Wong W.T.
        • Cukras C.
        • et al.
        Relationship between photoreceptor outer segment length and visual acuity in diabetic macular edema.
        Retina. 2010; 30: 63
        • Patel A.K.
        • Akinsoji E.
        • Hackam A.S.
        Defining the relationships among retinal function, layer thickness and visual behavior during oxidative stress-induced retinal degeneration.
        Curr Eye Res. 2016; 41: 977-986
        • Tao Y.
        • Chen T.
        • Liu Z.-Y.
        • Wang L.-Q.
        • Xu W.-W.
        • Qin L.-M.
        • et al.
        Topographic quantification of the transcorneal electrical stimulation (TES)–Induced protective effects on N-methyl-N-Nitrosourea–Treated retinas.
        Investig Ophthalmol Vis Sci. 2016; 57: 4614-4624
        • Kumar S.
        • Mondal A.C.
        Neuroprotective, neurotrophic and anti-oxidative role of Bacopa monnieri on CUS induced model of depression in rat.
        Neurochem Res. 2016; 41: 3083-3094
        • Zhang Z.
        • Wang W.
        • Zhong P.
        • Liu S.J.
        • Long J.Z.
        • Zhao L.
        • et al.
        Blockade of 2-arachidonoylglycerol hydrolysis produces antidepressant-like effects and enhances adult hippocampal neurogenesis and synaptic plasticity.
        Hippocampus. 2015; 25: 16-26
        • Conboy L.
        • Varea E.
        • Castro J.E.
        • Sakouhi-Ouertatani H.
        • Calandra T.
        • Lashuel H.A.
        • et al.
        Macrophage migration inhibitory factor is critically involved in basal and fluoxetine-stimulated adult hippocampal cell proliferation and in anxiety, depression, and memory-related behaviors.
        Mol Psychiatr. 2011; 16: 533-547
        • Sun F.-L.
        • Wang W.
        • Zuo W.
        • Xue J.-L.
        • Xu J-d
        • Ai H.-X.
        • et al.
        Promoting neurogenesis via Wnt/β-catenin signaling pathway accounts for the neurorestorative effects of morroniside against cerebral ischemia injury.
        Eur J Pharmacol. 2014; 738: 214-221
        • Kohler S.J.
        • Williams N.I.
        • Stanton G.B.
        • Cameron J.L.
        • Greenough W.T.
        Maturation time of new granule cells in the dentate gyrus of adult macaque monkeys exceeds six months.
        Proc Natl Acad Sci Unit States Am. 2011; 108: 10326-10331
        • Wiese C.
        • Rolletschek A.
        • Kania G.
        • Blyszczuk P.
        • Tarasov K.
        • Tarasova Y.
        • et al.
        Nestin expression–a property of multi-lineage progenitor cells?.
        Cell Mol Life Sci CMLS. 2004; 61: 2510-2522
        • Krishnasamy S.
        • Weng Y.-C.
        • Thammisetty S.S.
        • Phaneuf D.
        • Lalancette-Hebert M.
        • Kriz J.
        Molecular imaging of nestin in neuroinflammatory conditions reveals marked signal induction in activated microglia.
        J Neuroinflammation. 2017; 14: 1-14
        • de Pablos R.M.
        • Herrera A.J.
        • Espinosa-Oliva A.M.
        • Sarmiento M.
        • Muñoz M.F.
        • Machado A.
        • et al.
        Chronic stress enhances microglia activation and exacerbates death of nigral dopaminergic neurons under conditions of inflammation.
        J Neuroinflammation. 2014; 11: 1-18
        • Yin H.
        • Yin H.
        • Zhang W.
        • Miao Q.
        • Qin Z.
        • Guo S.
        • et al.
        Transcorneal electrical stimulation promotes survival of retinal ganglion cells after optic nerve transection in rats accompanied by reduced microglial activation and TNF-α expression.
        Brain Res. 2016; 1650: 10-20
        • Jassim A.H.
        • Cavanaugh M.
        • Shah J.S.
        • Willits R.
        • Inman D.M.
        Transcorneal electrical stimulation reduces neurodegenerative process in a mouse model of glaucoma.
        Ann Biomed Eng. 2021; 49: 858-870
        • Zhou W-t
        • Ni Y-q
        • Jin Z-b
        • Zhang M.
        • Wu J-h
        • Zhu Y.
        • et al.
        Electrical stimulation ameliorates light-induced photoreceptor degeneration in vitro via suppressing the proinflammatory effect of microglia and enhancing the neurotrophic potential of Müller cells.
        Exp Neurol. 2012; 238: 192-208
        • Liu D.
        • Xie K.
        • Yang X.
        • Gu J.
        • Ge L.
        • Wang X.
        • et al.
        Resveratrol reverses the effects of chronic unpredictable mild stress on behavior, serum corticosterone levels and BDNF expression in rats.
        Behav Brain Res. 2014; 264: 9-16
        • Raone A.
        • Cassanelli A.
        • Scheggi S.
        • Rauggi R.
        • Danielli B.
        • De Montis M.
        Hypothalamus–pituitary–adrenal modifications consequent to chronic stress exposure in an experimental model of depression in rats.
        Neuroscience. 2007; 146: 1734-1742
        • Lehmann M.L.
        • Mustafa T.
        • Eiden A.M.
        • Herkenham M.
        • Eiden L.E.
        PACAP-deficient mice show attenuated corticosterone secretion and fail to develop depressive behavior during chronic social defeat stress.
        Psychoneuroendocrinology. 2013; 38: 702-715
        • Keller J.
        • Gomez R.
        • Williams G.
        • Lembke A.
        • Lazzeroni L.
        • Murphy G.M.
        • et al.
        HPA axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition.
        Mol Psychiatr. 2017; 22: 527-536
        • Markopoulou K.
        • Papadopoulos A.
        • Juruena M.F.
        • Poon L.
        • Pariante C.M.
        • Cleare A.J.
        The ratio of cortisol/DHEA in treatment resistant depression.
        Psychoneuroendocrinology. 2009; 34: 19-26
        • Yau J.L.
        • Noble J.
        • Thomas S.
        • Kerwin R.
        • Morgan P.E.
        • Lightman S.
        • et al.
        The antidepressant desipramine requires the ABCB1 (Mdr1)-type p-glycoprotein to upregulate the glucocorticoid receptor in mice.
        Neuropsychopharmacology. 2007; 32: 2520-2529
        • Hinkelmann K.
        • Moritz S.
        • Botzenhardt J.
        • Muhtz C.
        • Wiedemann K.
        • Kellner M.
        • et al.
        Changes in cortisol secretion during antidepressive treatment and cognitive improvement in patients with major depression: a longitudinal study.
        Psychoneuroendocrinology. 2012; 37: 685-692
        • Piwowarska J.
        • Chimiak A.
        • Matsumoto H.
        • Dziklińska A.
        • Radziwoń-Zaleska M.
        • Szelenberger W.
        • et al.
        Serum cortisol concentration in patients with major depression after treatment with fluoxetine.
        Psychiatr Res. 2012; 198: 407-411
        • de Sousa Tomaz V.
        • Chaves Filho A.J.M.
        • Cordeiro R.C.
        • Jucá P.M.
        • Soares M.V.R.
        • Barroso P.N.
        • et al.
        Antidepressants of different classes cause distinct behavioral and brain pro-and anti-inflammatory changes in mice submitted to an inflammatory model of depression.
        J Affect Disord. 2020; 268: 188-200
        • Egeland M.
        • Guinaudie C.
        • Du Preez A.
        • Musaelyan K.
        • Zunszain P.
        • Fernandes C.
        • et al.
        Depletion of adult neurogenesis using the chemotherapy drug temozolomide in mice induces behavioural and biological changes relevant to depression.
        Transl Psychiatry. 2017; 7: e1101-e
        • Snyder J.S.
        • Soumier A.
        • Brewer M.
        • Pickel J.
        • Cameron H.A.
        Adult hippocampal neurogenesis buffers stress responses and depressive behaviour.
        Nature. 2011; 476: 458-461
        • Boyle L.M.
        A neuroplasticity hypothesis of chronic stress in the basolateral amygdala.
        Yale J Biol Med. 2013; 86: 117
        • Liu W.
        • Ge T.
        • Leng Y.
        • Pan Z.
        • Fan J.
        • Yang W.
        • et al.
        The role of neural plasticity in depression: from hippocampus to prefrontal cortex.
        Neural Plast. 2017; 2017
        • Kosten T.A.
        • Galloway M.P.
        • Duman R.S.
        • Russell D.S.
        • D'sa C.
        Repeated unpredictable stress and antidepressants differentially regulate expression of the bcl-2 family of apoptotic genes in rat cortical, hippocampal, and limbic brain structures.
        Neuropsychopharmacology. 2008; 33: 1545-1558
        • Ding L.
        • Zhang C.
        • Masood A.
        • Li J.
        • Sun J.
        • Nadeem A.
        • et al.
        Protective effects of phosphodiesterase 2 inhibitor on depression-and anxiety-like behaviors: involvement of antioxidant and anti-apoptotic mechanisms.
        Behav Brain Res. 2014; 268: 150-158
        • Colla A.R.
        • Pazini F.L.
        • Lieberknecht V.
        • Camargo A.
        • Rodrigues A.L.S.
        Ursolic acid abrogates depressive-like behavior and hippocampal pro-apoptotic imbalance induced by chronic unpredictable stress.
        Metab Brain Dis. 2021; 36: 437-446
        • Zhang L.
        • Luo J.
        • Zhang M.
        • Yao W.
        • Ma X.
        • Yu S.Y.
        Effects of curcumin on chronic, unpredictable, mild, stress-induced depressive-like behaviour and structural plasticity in the lateral amygdala of rats.
        Int J Neuropsychopharmacol. 2014; 17: 793-806
        • Kang J.
        • Wang Y.
        • Wang D.
        Endurance and resistance training mitigate the negative consequences of depression on synaptic plasticity through different molecular mechanisms.
        Int J Neurosci. 2020; 130: 541-550
        • Luo J.
        • Zhang L.
        • Ning N.
        • Jiang H.
        • Yu S.Y.
        Neotrofin reverses the effects of chronic unpredictable mild stress on behavior via regulating BDNF, PSD-95 and synaptophysin expression in rat.
        Behav Brain Res. 2013; 253: 48-53
        • Ma H.
        • Li C.
        • Wang J.
        • Zhang X.
        • Li M.
        • Zhang R.
        • et al.
        Amygdala-hippocampal innervation modulates stress-induced depressive-like behaviors through AMPA receptors.
        Proc Natl Acad Sci Unit States Am. 2021; 118
        • Woodburn S.C.
        • Bollinger J.L.
        • Wohleb E.S.
        Synaptic and behavioral effects of chronic stress are linked to dynamic and sex-specific changes in microglia function and astrocyte dystrophy.
        Neurobiol Stress. 2021; 14: 100312
        • Duman R.S.
        • Voleti B.
        Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents.
        Trends Neurosci. 2012; 35: 47-56
        • Kitagishi Y.
        • Kobayashi M.
        • Kikuta K.
        • Matsuda S.
        Roles of PI3K/AKT/GSK3/mTOR pathway in cell signaling of mental illnesses.
        Depress Res Treat. 2012; : 2012
        • Marsden W.
        Synaptic plasticity in depression: molecular, cellular and functional correlates.
        Prog Neuro Psychopharmacol Biol Psychiatr. 2013; 43: 168-184
        • Dagda R.K.
        • Banerjee T.D.
        Role of protein kinase A in regulating mitochondrial function and neuronal development: implications to neurodegenerative diseases.
        Rev Neurosci. 2015; 26: 359-370
        • Eagle A.L.
        • Knox D.
        • Roberts M.M.
        • Mulo K.
        • Liberzon I.
        • Galloway M.P.
        • et al.
        Single prolonged stress enhances hippocampal glucocorticoid receptor and phosphorylated protein kinase B levels.
        Neurosci Res. 2013; 75: 130-137
        • Yang P.-C.
        • Yang C.-H.
        • Huang C.-C.
        • Hsu K.-S.
        Phosphatidylinositol 3-kinase activation is required for stress protocol-induced modification of hippocampal synaptic plasticity.
        J Biol Chem. 2008; 283: 2631-2643
        • Lee S.Y.
        • Kang J.S.
        • Song G.Y.
        • Myung C.-S.
        Stress induces the expression of heterotrimeric G protein β subunits and the phosphorylation of PKB/Akt and ERK1/2 in rat brain.
        Neurosci Res. 2006; 56: 180-192
        • Dwivedi Y.
        • Pandey G.N.
        Adenylyl cyclase-cyclicAMP signaling in mood disorders: role of the crucial phosphorylating enzyme protein kinase A.
        Neuropsychiatric Dis Treat. 2008; 4: 161
        • Chen P.
        • Fan Y.
        • Li Y.
        • Sun Z.
        • Bissette G.
        • Zhu M.-Y.
        Chronic social defeat up-regulates expression of norepinephrine transporter in rat brains.
        Neurochem Int. 2012; 60: 9-20
        • Shelton R.C.
        • Hal Manier D.
        • Lewis D.A.
        Protein kinases A and C in post-mortem prefrontal cortex from persons with major depression and normal controls.
        Int J Neuropsychopharmacol. 2009; 12: 1223-1232
        • Réus G.Z.
        • Stringari R.B.
        • Ribeiro K.F.
        • Ferraro A.K.
        • Vitto M.F.
        • Cesconetto P.
        • et al.
        Ketamine plus imipramine treatment induces antidepressant-like behavior and increases CREB and BDNF protein levels and PKA and PKC phosphorylation in rat brain.
        Behav Brain Res. 2011; 221: 166-171
        • Yang L.
        • Shi L.-J.
        • Yu J.
        • Zhang Y.-Q.
        Activation of protein kinase A in the amygdala modulates anxiety-like behaviors in social defeat exposed mice.
        Mol Brain. 2016; 9: 1-13
        • Jankord R.
        • Herman J.P.
        Limbic regulation of hypothalamo-pituitary-adrenocortical function during acute and chronic stress.
        Ann N Y Acad Sci. 2008; 1148: 64
        • van Bodegom M.
        • Homberg J.R.
        • Henckens M.J.
        Modulation of the hypothalamic-pituitary-adrenal axis by early life stress exposure.
        Front Cell Neurosci. 2017; 11: 87
        • Pittman Q.
        • Blume H.
        • Renaud L.
        Connections of the hypothalamic paraventricular nucleus with the neurohypophysis, median eminence, amygdala, lateral septum and midbrain periaqueductal gray: an electrophysiological study in the rat.
        Brain Res. 1981; 215: 15-28